\
| Variant ID: vg1107392564 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 7392564 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
GAGCGTGAGAGATATATAGAAGAGATAGAAGAGAGAGAGAAACTGATAGGTGGGGCCCACTTATTTTTTAATAAATAAATTGCTGATTGGACTACCACGT[A/G]
GACCAAAACCACCGCAGATTAGATCGAGGGTGGTAATTCGTCCGGTTTACATAGTTGGGGGTGAAGAATGTCTGATTTTTTATGGTATTGGGGGTAATTC
GAATTACCCCCAATACCATAAAAAATCAGACATTCTTCACCCCCAACTATGTAAACCGGACGAATTACCACCCTCGATCTAATCTGCGGTGGTTTTGGTC[T/C]
ACGTGGTAGTCCAATCAGCAATTTATTTATTAAAAAATAAGTGGGCCCCACCTATCAGTTTCTCTCTCTCTTCTATCTCTTCTATATATCTCTCACGCTC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 61.80% | 4.10% | 0.91% | 33.20% | NA |
| All Indica | 2759 | 50.20% | 0.10% | 0.62% | 49.04% | NA |
| All Japonica | 1512 | 79.90% | 12.00% | 0.93% | 7.14% | NA |
| Aus | 269 | 66.50% | 0.40% | 3.72% | 29.37% | NA |
| Indica I | 595 | 27.60% | 0.20% | 0.84% | 71.43% | NA |
| Indica II | 465 | 69.20% | 0.00% | 0.22% | 30.54% | NA |
| Indica III | 913 | 56.10% | 0.20% | 0.44% | 43.26% | NA |
| Indica Intermediate | 786 | 49.40% | 0.00% | 0.89% | 49.75% | NA |
| Temperate Japonica | 767 | 95.40% | 0.70% | 1.04% | 2.87% | NA |
| Tropical Japonica | 504 | 56.20% | 34.10% | 0.99% | 8.73% | NA |
| Japonica Intermediate | 241 | 80.10% | 2.10% | 0.41% | 17.43% | NA |
| VI/Aromatic | 96 | 97.90% | 0.00% | 0.00% | 2.08% | NA |
| Intermediate | 90 | 57.80% | 10.00% | 2.22% | 30.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1107392564 | A -> DEL | N | N | silent_mutation | Average:52.579; most accessible tissue: Minghui63 root, score: 89.072 | N | N | N | N |
| vg1107392564 | A -> G | LOC_Os11g13490.1 | intron_variant ; MODIFIER | silent_mutation | Average:52.579; most accessible tissue: Minghui63 root, score: 89.072 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1107392564 | 3.44E-07 | 2.57E-09 | mr1076 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1107392564 | NA | 6.81E-08 | mr1082 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1107392564 | 6.30E-06 | 2.17E-08 | mr1083 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1107392564 | 2.17E-06 | 2.17E-06 | mr1085 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1107392564 | NA | 1.04E-06 | mr1103 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1107392564 | NA | 5.71E-06 | mr1107 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1107392564 | 1.46E-06 | 1.46E-06 | mr1204 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1107392564 | 1.68E-07 | 4.39E-09 | mr1226 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1107392564 | NA | 7.65E-06 | mr1227 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1107392564 | 2.09E-07 | 1.23E-08 | mr1411 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1107392564 | NA | 1.53E-06 | mr1560 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1107392564 | 3.61E-06 | 3.60E-06 | mr1076_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1107392564 | NA | 8.05E-07 | mr1082_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1107392564 | NA | 3.13E-07 | mr1226_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |