Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1107384719:

Variant ID: vg1107384719 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 7384719
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GATATAAAAGGGACCCCCCGGGAGGACCTAAGGCATCGAATCTCAGAGCCAACACATCCACCACAGCCCACGGAGTTGAAGCCTATAGGAGCCAAGTCGC[C/T]
GGGAGATCTAATCGAACCTGTTCGTTTACGACCTCGTCGGTATCATCGAGTTCCGCTTTTCCCTTTGTAATCTGTGGTTTCCATTATATAATCCCATACC

Reverse complement sequence

GGTATGGGATTATATAATGGAAACCACAGATTACAAAGGGAAAAGCGGAACTCGATGATACCGACGAGGTCGTAAACGAACAGGTTCGATTAGATCTCCC[G/A]
GCGACTTGGCTCCTATAGGCTTCAACTCCGTGGGCTGTGGTGGATGTGTTGGCTCTGAGATTCGATGCCTTAGGTCCTCCCGGGGGGTCCCTTTTATATC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	38.70%	27.00%	1.04%	33.35%	NA
All Indica	2759	4.90%	44.80%	1.56%	48.71%	NA
All Japonica	1512	91.70%	0.70%	0.26%	7.28%	NA
Aus	269	63.20%	2.20%	0.00%	34.57%	NA
Indica I	595	2.40%	22.70%	2.02%	72.94%	NA
Indica II	465	2.20%	67.70%	0.65%	29.46%	NA
Indica III	913	3.80%	53.10%	1.10%	41.95%	NA
Indica Intermediate	786	9.80%	38.30%	2.29%	49.62%	NA
Temperate Japonica	767	96.50%	0.40%	0.26%	2.87%	NA
Tropical Japonica	504	89.50%	1.40%	0.40%	8.73%	NA
Japonica Intermediate	241	81.30%	0.40%	0.00%	18.26%	NA
VI/Aromatic	96	97.90%	0.00%	0.00%	2.08%	NA
Intermediate	90	44.40%	23.30%	2.22%	30.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1107384719	C -> T	LOC_Os11g13480.1	upstream_gene_variant ; 700.0bp to feature; MODIFIER	silent_mutation	Average:25.514; most accessible tissue: Minghui63 young leaf, score: 63.571	N	N	N	N
vg1107384719	C -> T	LOC_Os11g13459.1	downstream_gene_variant ; 4714.0bp to feature; MODIFIER	silent_mutation	Average:25.514; most accessible tissue: Minghui63 young leaf, score: 63.571	N	N	N	N
vg1107384719	C -> T	LOC_Os11g13480-LOC_Os11g13490	intergenic_region ; MODIFIER	silent_mutation	Average:25.514; most accessible tissue: Minghui63 young leaf, score: 63.571	N	N	N	N
vg1107384719	C -> DEL	N	N	silent_mutation	Average:25.514; most accessible tissue: Minghui63 young leaf, score: 63.571	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1107384719	NA	4.66E-06	mr1150	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107384719	NA	3.52E-07	mr1149_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107384719	NA	6.79E-07	mr1260_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107384719	NA	5.87E-08	mr1302_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107384719	NA	1.59E-07	mr1441_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107384719	NA	6.33E-06	mr1609_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107384719	NA	3.93E-07	mr1824_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107384719	7.65E-08	NA	mr1877_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107384719	8.90E-06	NA	mr1877_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107384719	NA	3.47E-07	mr1885_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251