\
| Variant ID: vg1107384719 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 7384719 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GATATAAAAGGGACCCCCCGGGAGGACCTAAGGCATCGAATCTCAGAGCCAACACATCCACCACAGCCCACGGAGTTGAAGCCTATAGGAGCCAAGTCGC[C/T]
GGGAGATCTAATCGAACCTGTTCGTTTACGACCTCGTCGGTATCATCGAGTTCCGCTTTTCCCTTTGTAATCTGTGGTTTCCATTATATAATCCCATACC
GGTATGGGATTATATAATGGAAACCACAGATTACAAAGGGAAAAGCGGAACTCGATGATACCGACGAGGTCGTAAACGAACAGGTTCGATTAGATCTCCC[G/A]
GCGACTTGGCTCCTATAGGCTTCAACTCCGTGGGCTGTGGTGGATGTGTTGGCTCTGAGATTCGATGCCTTAGGTCCTCCCGGGGGGTCCCTTTTATATC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 38.70% | 27.00% | 1.04% | 33.35% | NA |
| All Indica | 2759 | 4.90% | 44.80% | 1.56% | 48.71% | NA |
| All Japonica | 1512 | 91.70% | 0.70% | 0.26% | 7.28% | NA |
| Aus | 269 | 63.20% | 2.20% | 0.00% | 34.57% | NA |
| Indica I | 595 | 2.40% | 22.70% | 2.02% | 72.94% | NA |
| Indica II | 465 | 2.20% | 67.70% | 0.65% | 29.46% | NA |
| Indica III | 913 | 3.80% | 53.10% | 1.10% | 41.95% | NA |
| Indica Intermediate | 786 | 9.80% | 38.30% | 2.29% | 49.62% | NA |
| Temperate Japonica | 767 | 96.50% | 0.40% | 0.26% | 2.87% | NA |
| Tropical Japonica | 504 | 89.50% | 1.40% | 0.40% | 8.73% | NA |
| Japonica Intermediate | 241 | 81.30% | 0.40% | 0.00% | 18.26% | NA |
| VI/Aromatic | 96 | 97.90% | 0.00% | 0.00% | 2.08% | NA |
| Intermediate | 90 | 44.40% | 23.30% | 2.22% | 30.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1107384719 | C -> T | LOC_Os11g13480.1 | upstream_gene_variant ; 700.0bp to feature; MODIFIER | silent_mutation | Average:25.514; most accessible tissue: Minghui63 young leaf, score: 63.571 | N | N | N | N |
| vg1107384719 | C -> T | LOC_Os11g13459.1 | downstream_gene_variant ; 4714.0bp to feature; MODIFIER | silent_mutation | Average:25.514; most accessible tissue: Minghui63 young leaf, score: 63.571 | N | N | N | N |
| vg1107384719 | C -> T | LOC_Os11g13480-LOC_Os11g13490 | intergenic_region ; MODIFIER | silent_mutation | Average:25.514; most accessible tissue: Minghui63 young leaf, score: 63.571 | N | N | N | N |
| vg1107384719 | C -> DEL | N | N | silent_mutation | Average:25.514; most accessible tissue: Minghui63 young leaf, score: 63.571 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1107384719 | NA | 4.66E-06 | mr1150 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1107384719 | NA | 3.52E-07 | mr1149_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1107384719 | NA | 6.79E-07 | mr1260_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1107384719 | NA | 5.87E-08 | mr1302_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1107384719 | NA | 1.59E-07 | mr1441_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1107384719 | NA | 6.33E-06 | mr1609_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1107384719 | NA | 3.93E-07 | mr1824_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1107384719 | 7.65E-08 | NA | mr1877_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1107384719 | 8.90E-06 | NA | mr1877_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1107384719 | NA | 3.47E-07 | mr1885_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |