\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1107384719:

Variant ID: vg1107384719 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 7384719
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GATATAAAAGGGACCCCCCGGGAGGACCTAAGGCATCGAATCTCAGAGCCAACACATCCACCACAGCCCACGGAGTTGAAGCCTATAGGAGCCAAGTCGC[C/T]
GGGAGATCTAATCGAACCTGTTCGTTTACGACCTCGTCGGTATCATCGAGTTCCGCTTTTCCCTTTGTAATCTGTGGTTTCCATTATATAATCCCATACC

Reverse complement sequence

GGTATGGGATTATATAATGGAAACCACAGATTACAAAGGGAAAAGCGGAACTCGATGATACCGACGAGGTCGTAAACGAACAGGTTCGATTAGATCTCCC[G/A]
GCGACTTGGCTCCTATAGGCTTCAACTCCGTGGGCTGTGGTGGATGTGTTGGCTCTGAGATTCGATGCCTTAGGTCCTCCCGGGGGGTCCCTTTTATATC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 38.70% 27.00% 1.04% 33.35% NA
All Indica  2759 4.90% 44.80% 1.56% 48.71% NA
All Japonica  1512 91.70% 0.70% 0.26% 7.28% NA
Aus  269 63.20% 2.20% 0.00% 34.57% NA
Indica I  595 2.40% 22.70% 2.02% 72.94% NA
Indica II  465 2.20% 67.70% 0.65% 29.46% NA
Indica III  913 3.80% 53.10% 1.10% 41.95% NA
Indica Intermediate  786 9.80% 38.30% 2.29% 49.62% NA
Temperate Japonica  767 96.50% 0.40% 0.26% 2.87% NA
Tropical Japonica  504 89.50% 1.40% 0.40% 8.73% NA
Japonica Intermediate  241 81.30% 0.40% 0.00% 18.26% NA
VI/Aromatic  96 97.90% 0.00% 0.00% 2.08% NA
Intermediate  90 44.40% 23.30% 2.22% 30.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1107384719 C -> T LOC_Os11g13480.1 upstream_gene_variant ; 700.0bp to feature; MODIFIER silent_mutation Average:25.514; most accessible tissue: Minghui63 young leaf, score: 63.571 N N N N
vg1107384719 C -> T LOC_Os11g13459.1 downstream_gene_variant ; 4714.0bp to feature; MODIFIER silent_mutation Average:25.514; most accessible tissue: Minghui63 young leaf, score: 63.571 N N N N
vg1107384719 C -> T LOC_Os11g13480-LOC_Os11g13490 intergenic_region ; MODIFIER silent_mutation Average:25.514; most accessible tissue: Minghui63 young leaf, score: 63.571 N N N N
vg1107384719 C -> DEL N N silent_mutation Average:25.514; most accessible tissue: Minghui63 young leaf, score: 63.571 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1107384719 NA 4.66E-06 mr1150 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107384719 NA 3.52E-07 mr1149_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107384719 NA 6.79E-07 mr1260_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107384719 NA 5.87E-08 mr1302_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107384719 NA 1.59E-07 mr1441_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107384719 NA 6.33E-06 mr1609_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107384719 NA 3.93E-07 mr1824_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107384719 7.65E-08 NA mr1877_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107384719 8.90E-06 NA mr1877_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107384719 NA 3.47E-07 mr1885_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251