\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1107375253:

Variant ID: vg1107375253 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 7375253
Reference Allele: GAlternative Allele: C,T
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, G: 0.01, others allele: 0.00, population size: 81. )

Flanking Sequence (100 bp) in Reference Genome:


GCAATCTCCACGATCACCTGAATAGCCGCCGAGGGACGCGACGCGCACGAGACAACGAGAACCGTTCCCGACATCGCGTCTCTTCGCGACGTCACGATAA[G/C,T]
GGAGAACGAGGAGGCCGTTCGAGCGAAGACCGAGACCGTGATAACTGCCACAACCGCCACGATCATGACGATCGCGAACGGCAGGTGCTGGGCGATACTG

Reverse complement sequence

CAGTATCGCCCAGCACCTGCCGTTCGCGATCGTCATGATCGTGGCGGTTGTGGCAGTTATCACGGTCTCGGTCTTCGCTCGAACGGCCTCCTCGTTCTCC[C/G,A]
TTATCGTGACGTCGCGAAGAGACGCGATGTCGGGAACGGTTCTCGTTGTCTCGTGCGCGTCGCGTCCCTCGGCGGCTATTCAGGTGATCGTGGAGATTGC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 41.90% 22.80% 2.03% 32.90% T: 0.40%
All Indica  2759 47.20% 2.50% 2.21% 48.10% T: 0.04%
All Japonica  1512 30.40% 59.40% 1.85% 7.34% T: 1.06%
Aus  269 64.30% 0.70% 1.86% 33.09% NA
Indica I  595 23.00% 2.40% 3.03% 71.43% T: 0.17%
Indica II  465 68.40% 0.90% 1.08% 29.68% NA
Indica III  913 55.50% 1.20% 2.19% 41.07% NA
Indica Intermediate  786 43.30% 5.00% 2.29% 49.49% NA
Temperate Japonica  767 32.10% 63.40% 1.69% 2.74% T: 0.13%
Tropical Japonica  504 32.10% 53.00% 2.58% 9.33% T: 2.98%
Japonica Intermediate  241 21.20% 60.20% 0.83% 17.84% NA
VI/Aromatic  96 14.60% 83.30% 0.00% 2.08% NA
Intermediate  90 33.30% 33.30% 2.22% 28.89% T: 2.22%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1107375253 G -> T LOC_Os11g13459.1 intron_variant ; MODIFIER silent_mutation Average:34.266; most accessible tissue: Minghui63 young leaf, score: 69.4 N N N N
vg1107375253 G -> DEL N N silent_mutation Average:34.266; most accessible tissue: Minghui63 young leaf, score: 69.4 N N N N
vg1107375253 G -> C LOC_Os11g13459.1 intron_variant ; MODIFIER silent_mutation Average:34.266; most accessible tissue: Minghui63 young leaf, score: 69.4 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1107375253 NA 8.83E-06 mr1058_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107375253 NA 9.06E-06 mr1084_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107375253 NA 1.32E-06 mr1105_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107375253 4.96E-10 3.92E-10 mr1134_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107375253 5.62E-06 1.07E-06 mr1206_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107375253 6.38E-06 NA mr1224_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107375253 NA 4.66E-06 mr1232_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107375253 NA 2.09E-06 mr1260_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107375253 8.45E-06 8.45E-06 mr1285_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107375253 9.66E-06 9.66E-06 mr1290_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107375253 NA 9.56E-06 mr1306_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107375253 3.46E-06 NA mr1310_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107375253 1.79E-06 1.79E-06 mr1353_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107375253 2.38E-06 2.38E-06 mr1356_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107375253 2.24E-06 2.24E-06 mr1357_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107375253 9.17E-06 9.17E-06 mr1384_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107375253 NA 8.26E-06 mr1402_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107375253 1.13E-06 1.13E-06 mr1475_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107375253 2.68E-08 3.02E-08 mr1504_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107375253 NA 5.99E-06 mr1605_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107375253 NA 3.08E-07 mr1609_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107375253 1.84E-06 1.84E-06 mr1640_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107375253 2.17E-06 2.17E-06 mr1670_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107375253 7.84E-06 1.19E-06 mr1672_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107375253 6.73E-06 6.73E-06 mr1710_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107375253 8.78E-07 5.66E-07 mr1713_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107375253 2.51E-06 2.51E-06 mr1736_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107375253 NA 2.13E-06 mr1763_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107375253 2.08E-06 2.08E-06 mr1783_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107375253 2.03E-06 1.45E-06 mr1785_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107375253 6.64E-06 6.64E-06 mr1804_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107375253 NA 3.19E-06 mr1837_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107375253 NA 9.06E-06 mr1862_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107375253 5.43E-07 1.01E-06 mr1873_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107375253 NA 1.07E-06 mr1906_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107375253 7.76E-06 8.31E-07 mr1909_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107375253 4.14E-06 4.15E-06 mr1939_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107375253 2.79E-06 2.79E-06 mr1941_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107375253 3.82E-07 1.13E-07 mr1943_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107375253 9.88E-06 1.49E-06 mr1959_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107375253 NA 2.73E-06 mr1960_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251