\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1107373570:

Variant ID: vg1107373570 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 7373570
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, T: 0.01, others allele: 0.00, population size: 81. )

Flanking Sequence (100 bp) in Reference Genome:


TTTTATTGTTGATTTGCTAATGGCCAGTGTTAATCCCTGTATTTTCACTCAAATCGAATGGGATGCACATTGTCAGGGTTACGGGTAAGGTATATCCTTT[A/T]
CCCTTCGATATACGTCACATATCGATACGGTATACTTGCGTGTACACGGACATTTTCGGCATACGTTAAGAAAATTCATCATGGAGTTCACAGATGGAAG

Reverse complement sequence

CTTCCATCTGTGAACTCCATGATGAATTTTCTTAACGTATGCCGAAAATGTCCGTGTACACGCAAGTATACCGTATCGATATGTGACGTATATCGAAGGG[T/A]
AAAGGATATACCTTACCCGTAACCCTGACAATGTGCATCCCATTCGATTTGAGTGAAAATACAGGGATTAACACTGGCCATTAGCAAATCAACAATAAAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 38.60% 27.00% 0.78% 33.62% NA
All Indica  2759 4.90% 44.80% 1.23% 49.08% NA
All Japonica  1512 91.50% 0.80% 0.13% 7.54% NA
Aus  269 63.60% 2.60% 0.00% 33.83% NA
Indica I  595 2.90% 22.90% 2.18% 72.10% NA
Indica II  465 1.30% 67.70% 0.22% 30.75% NA
Indica III  913 3.90% 52.90% 0.66% 42.50% NA
Indica Intermediate  786 9.70% 38.40% 1.78% 50.13% NA
Temperate Japonica  767 96.50% 0.50% 0.00% 3.00% NA
Tropical Japonica  504 89.10% 1.40% 0.40% 9.13% NA
Japonica Intermediate  241 80.90% 0.40% 0.00% 18.67% NA
VI/Aromatic  96 97.90% 0.00% 0.00% 2.08% NA
Intermediate  90 45.60% 22.20% 1.11% 31.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1107373570 A -> T LOC_Os11g13459.1 upstream_gene_variant ; 448.0bp to feature; MODIFIER silent_mutation Average:30.242; most accessible tissue: Minghui63 young leaf, score: 58.21 N N N N
vg1107373570 A -> T LOC_Os11g13440-LOC_Os11g13459 intergenic_region ; MODIFIER silent_mutation Average:30.242; most accessible tissue: Minghui63 young leaf, score: 58.21 N N N N
vg1107373570 A -> DEL N N silent_mutation Average:30.242; most accessible tissue: Minghui63 young leaf, score: 58.21 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1107373570 NA 4.59E-06 mr1011 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107373570 NA 1.12E-06 mr1157 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107373570 NA 5.79E-07 mr1272 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107373570 NA 6.27E-06 mr1502 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107373570 NA 3.55E-08 mr1535 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107373570 NA 2.99E-07 mr1756 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107373570 NA 4.73E-06 mr1609_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251