Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1107373570:

Variant ID: vg1107373570 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 7373570
Reference Allele: A	Alternative Allele: T
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, T: 0.01, others allele: 0.00, population size: 81. )

Flanking Sequence (100 bp) in Reference Genome:

TTTTATTGTTGATTTGCTAATGGCCAGTGTTAATCCCTGTATTTTCACTCAAATCGAATGGGATGCACATTGTCAGGGTTACGGGTAAGGTATATCCTTT[A/T]
CCCTTCGATATACGTCACATATCGATACGGTATACTTGCGTGTACACGGACATTTTCGGCATACGTTAAGAAAATTCATCATGGAGTTCACAGATGGAAG

Reverse complement sequence

CTTCCATCTGTGAACTCCATGATGAATTTTCTTAACGTATGCCGAAAATGTCCGTGTACACGCAAGTATACCGTATCGATATGTGACGTATATCGAAGGG[T/A]
AAAGGATATACCTTACCCGTAACCCTGACAATGTGCATCCCATTCGATTTGAGTGAAAATACAGGGATTAACACTGGCCATTAGCAAATCAACAATAAAA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	38.60%	27.00%	0.78%	33.62%	NA
All Indica	2759	4.90%	44.80%	1.23%	49.08%	NA
All Japonica	1512	91.50%	0.80%	0.13%	7.54%	NA
Aus	269	63.60%	2.60%	0.00%	33.83%	NA
Indica I	595	2.90%	22.90%	2.18%	72.10%	NA
Indica II	465	1.30%	67.70%	0.22%	30.75%	NA
Indica III	913	3.90%	52.90%	0.66%	42.50%	NA
Indica Intermediate	786	9.70%	38.40%	1.78%	50.13%	NA
Temperate Japonica	767	96.50%	0.50%	0.00%	3.00%	NA
Tropical Japonica	504	89.10%	1.40%	0.40%	9.13%	NA
Japonica Intermediate	241	80.90%	0.40%	0.00%	18.67%	NA
VI/Aromatic	96	97.90%	0.00%	0.00%	2.08%	NA
Intermediate	90	45.60%	22.20%	1.11%	31.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1107373570	A -> T	LOC_Os11g13459.1	upstream_gene_variant ; 448.0bp to feature; MODIFIER	silent_mutation	Average:30.242; most accessible tissue: Minghui63 young leaf, score: 58.21	N	N	N	N
vg1107373570	A -> T	LOC_Os11g13440-LOC_Os11g13459	intergenic_region ; MODIFIER	silent_mutation	Average:30.242; most accessible tissue: Minghui63 young leaf, score: 58.21	N	N	N	N
vg1107373570	A -> DEL	N	N	silent_mutation	Average:30.242; most accessible tissue: Minghui63 young leaf, score: 58.21	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1107373570	NA	4.59E-06	mr1011	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107373570	NA	1.12E-06	mr1157	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107373570	NA	5.79E-07	mr1272	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107373570	NA	6.27E-06	mr1502	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107373570	NA	3.55E-08	mr1535	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107373570	NA	2.99E-07	mr1756	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107373570	NA	4.73E-06	mr1609_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251