\
| Variant ID: vg1107373570 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 7373570 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, T: 0.01, others allele: 0.00, population size: 81. )
TTTTATTGTTGATTTGCTAATGGCCAGTGTTAATCCCTGTATTTTCACTCAAATCGAATGGGATGCACATTGTCAGGGTTACGGGTAAGGTATATCCTTT[A/T]
CCCTTCGATATACGTCACATATCGATACGGTATACTTGCGTGTACACGGACATTTTCGGCATACGTTAAGAAAATTCATCATGGAGTTCACAGATGGAAG
CTTCCATCTGTGAACTCCATGATGAATTTTCTTAACGTATGCCGAAAATGTCCGTGTACACGCAAGTATACCGTATCGATATGTGACGTATATCGAAGGG[T/A]
AAAGGATATACCTTACCCGTAACCCTGACAATGTGCATCCCATTCGATTTGAGTGAAAATACAGGGATTAACACTGGCCATTAGCAAATCAACAATAAAA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 38.60% | 27.00% | 0.78% | 33.62% | NA |
| All Indica | 2759 | 4.90% | 44.80% | 1.23% | 49.08% | NA |
| All Japonica | 1512 | 91.50% | 0.80% | 0.13% | 7.54% | NA |
| Aus | 269 | 63.60% | 2.60% | 0.00% | 33.83% | NA |
| Indica I | 595 | 2.90% | 22.90% | 2.18% | 72.10% | NA |
| Indica II | 465 | 1.30% | 67.70% | 0.22% | 30.75% | NA |
| Indica III | 913 | 3.90% | 52.90% | 0.66% | 42.50% | NA |
| Indica Intermediate | 786 | 9.70% | 38.40% | 1.78% | 50.13% | NA |
| Temperate Japonica | 767 | 96.50% | 0.50% | 0.00% | 3.00% | NA |
| Tropical Japonica | 504 | 89.10% | 1.40% | 0.40% | 9.13% | NA |
| Japonica Intermediate | 241 | 80.90% | 0.40% | 0.00% | 18.67% | NA |
| VI/Aromatic | 96 | 97.90% | 0.00% | 0.00% | 2.08% | NA |
| Intermediate | 90 | 45.60% | 22.20% | 1.11% | 31.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1107373570 | A -> T | LOC_Os11g13459.1 | upstream_gene_variant ; 448.0bp to feature; MODIFIER | silent_mutation | Average:30.242; most accessible tissue: Minghui63 young leaf, score: 58.21 | N | N | N | N |
| vg1107373570 | A -> T | LOC_Os11g13440-LOC_Os11g13459 | intergenic_region ; MODIFIER | silent_mutation | Average:30.242; most accessible tissue: Minghui63 young leaf, score: 58.21 | N | N | N | N |
| vg1107373570 | A -> DEL | N | N | silent_mutation | Average:30.242; most accessible tissue: Minghui63 young leaf, score: 58.21 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1107373570 | NA | 4.59E-06 | mr1011 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1107373570 | NA | 1.12E-06 | mr1157 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1107373570 | NA | 5.79E-07 | mr1272 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1107373570 | NA | 6.27E-06 | mr1502 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1107373570 | NA | 3.55E-08 | mr1535 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1107373570 | NA | 2.99E-07 | mr1756 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1107373570 | NA | 4.73E-06 | mr1609_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |