Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1107370068:

Variant ID: vg1107370068 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 7370068
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.80, G: 0.20, others allele: 0.00, population size: 92. )

Flanking Sequence (100 bp) in Reference Genome:

GTGCGTTGGCACCGTCGTCGTCACGATAGTCGTTGTCGCGTGTCGCCGGGAGAGGGAGGAGCCAAGCCATGGCCACTCCTCCTCCGTCCACCGGCCTCCT[A/G]
TTAACAGTGAAATTTGGTAATCGGCAAAGACGTCATCGGCTTAGAATCATTATCAGCTGCAGTATCTCGGAATCAGCCGATGGGAGTTATCAAGTCGCCA

Reverse complement sequence

TGGCGACTTGATAACTCCCATCGGCTGATTCCGAGATACTGCAGCTGATAATGATTCTAAGCCGATGACGTCTTTGCCGATTACCAAATTTCACTGTTAA[T/C]
AGGAGGCCGGTGGACGGAGGAGGAGTGGCCATGGCTTGGCTCCTCCCTCTCCCGGCGACACGCGACAACGACTATCGTGACGACGACGGTGCCAACGCAC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	40.60%	26.40%	3.00%	29.96%	NA
All Indica	2759	8.20%	43.80%	4.57%	43.46%	NA
All Japonica	1512	91.70%	0.70%	0.73%	6.88%	NA
Aus	269	63.60%	3.70%	0.00%	32.71%	NA
Indica I	595	4.70%	28.10%	2.35%	64.87%	NA
Indica II	465	1.50%	67.30%	1.08%	30.11%	NA
Indica III	913	11.00%	47.40%	8.11%	33.52%	NA
Indica Intermediate	786	11.50%	37.70%	4.20%	46.69%	NA
Temperate Japonica	767	96.30%	0.40%	0.13%	3.13%	NA
Tropical Japonica	504	89.70%	0.80%	1.98%	7.54%	NA
Japonica Intermediate	241	81.30%	1.20%	0.00%	17.43%	NA
VI/Aromatic	96	97.90%	0.00%	0.00%	2.08%	NA
Intermediate	90	47.80%	21.10%	5.56%	25.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1107370068	A -> DEL	N	N	silent_mutation	Average:34.855; most accessible tissue: Minghui63 young leaf, score: 58.21	N	N	N	N
vg1107370068	A -> G	LOC_Os11g13459.1	upstream_gene_variant ; 3950.0bp to feature; MODIFIER	silent_mutation	Average:34.855; most accessible tissue: Minghui63 young leaf, score: 58.21	N	N	N	N
vg1107370068	A -> G	LOC_Os11g13440.1	downstream_gene_variant ; 2207.0bp to feature; MODIFIER	silent_mutation	Average:34.855; most accessible tissue: Minghui63 young leaf, score: 58.21	N	N	N	N
vg1107370068	A -> G	LOC_Os11g13440-LOC_Os11g13459	intergenic_region ; MODIFIER	silent_mutation	Average:34.855; most accessible tissue: Minghui63 young leaf, score: 58.21	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1107370068	NA	1.25E-06	mr1285	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107370068	2.08E-06	2.07E-06	mr1340	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107370068	5.33E-06	5.33E-06	mr1340	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107370068	3.36E-06	3.35E-06	mr1429	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107370068	NA	1.46E-06	mr1041_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107370068	NA	8.63E-09	mr1302_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107370068	NA	5.23E-06	mr1403_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107370068	NA	5.09E-07	mr1418_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107370068	NA	9.84E-06	mr1419_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107370068	NA	3.26E-07	mr1488_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107370068	NA	1.21E-09	mr1506_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107370068	NA	4.96E-09	mr1604_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107370068	NA	4.90E-06	mr1604_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107370068	NA	9.87E-09	mr1659_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107370068	NA	6.98E-09	mr1824_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107370068	NA	1.65E-06	mr1824_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107370068	NA	6.90E-06	mr1869_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107370068	NA	3.45E-06	mr1894_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107370068	NA	8.73E-06	mr1992_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251