\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1107370068:

Variant ID: vg1107370068 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 7370068
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.80, G: 0.20, others allele: 0.00, population size: 92. )

Flanking Sequence (100 bp) in Reference Genome:


GTGCGTTGGCACCGTCGTCGTCACGATAGTCGTTGTCGCGTGTCGCCGGGAGAGGGAGGAGCCAAGCCATGGCCACTCCTCCTCCGTCCACCGGCCTCCT[A/G]
TTAACAGTGAAATTTGGTAATCGGCAAAGACGTCATCGGCTTAGAATCATTATCAGCTGCAGTATCTCGGAATCAGCCGATGGGAGTTATCAAGTCGCCA

Reverse complement sequence

TGGCGACTTGATAACTCCCATCGGCTGATTCCGAGATACTGCAGCTGATAATGATTCTAAGCCGATGACGTCTTTGCCGATTACCAAATTTCACTGTTAA[T/C]
AGGAGGCCGGTGGACGGAGGAGGAGTGGCCATGGCTTGGCTCCTCCCTCTCCCGGCGACACGCGACAACGACTATCGTGACGACGACGGTGCCAACGCAC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 40.60% 26.40% 3.00% 29.96% NA
All Indica  2759 8.20% 43.80% 4.57% 43.46% NA
All Japonica  1512 91.70% 0.70% 0.73% 6.88% NA
Aus  269 63.60% 3.70% 0.00% 32.71% NA
Indica I  595 4.70% 28.10% 2.35% 64.87% NA
Indica II  465 1.50% 67.30% 1.08% 30.11% NA
Indica III  913 11.00% 47.40% 8.11% 33.52% NA
Indica Intermediate  786 11.50% 37.70% 4.20% 46.69% NA
Temperate Japonica  767 96.30% 0.40% 0.13% 3.13% NA
Tropical Japonica  504 89.70% 0.80% 1.98% 7.54% NA
Japonica Intermediate  241 81.30% 1.20% 0.00% 17.43% NA
VI/Aromatic  96 97.90% 0.00% 0.00% 2.08% NA
Intermediate  90 47.80% 21.10% 5.56% 25.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1107370068 A -> DEL N N silent_mutation Average:34.855; most accessible tissue: Minghui63 young leaf, score: 58.21 N N N N
vg1107370068 A -> G LOC_Os11g13459.1 upstream_gene_variant ; 3950.0bp to feature; MODIFIER silent_mutation Average:34.855; most accessible tissue: Minghui63 young leaf, score: 58.21 N N N N
vg1107370068 A -> G LOC_Os11g13440.1 downstream_gene_variant ; 2207.0bp to feature; MODIFIER silent_mutation Average:34.855; most accessible tissue: Minghui63 young leaf, score: 58.21 N N N N
vg1107370068 A -> G LOC_Os11g13440-LOC_Os11g13459 intergenic_region ; MODIFIER silent_mutation Average:34.855; most accessible tissue: Minghui63 young leaf, score: 58.21 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1107370068 NA 1.25E-06 mr1285 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107370068 2.08E-06 2.07E-06 mr1340 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107370068 5.33E-06 5.33E-06 mr1340 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107370068 3.36E-06 3.35E-06 mr1429 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107370068 NA 1.46E-06 mr1041_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107370068 NA 8.63E-09 mr1302_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107370068 NA 5.23E-06 mr1403_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107370068 NA 5.09E-07 mr1418_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107370068 NA 9.84E-06 mr1419_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107370068 NA 3.26E-07 mr1488_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107370068 NA 1.21E-09 mr1506_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107370068 NA 4.96E-09 mr1604_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107370068 NA 4.90E-06 mr1604_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107370068 NA 9.87E-09 mr1659_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107370068 NA 6.98E-09 mr1824_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107370068 NA 1.65E-06 mr1824_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107370068 NA 6.90E-06 mr1869_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107370068 NA 3.45E-06 mr1894_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107370068 NA 8.73E-06 mr1992_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251