Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1107342410:

Variant ID: vg1107342410 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 7342410
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GGAGGGCATGGGTAAAGGAGATCCGGGAGCTCGCCTACGACATCGAGGACTGCATAGATCTGTTCGTCCACCGCTCCAACCACGAATTCTCCGCCGGCGG[T/C]
GGCGTCAGGAGGCTCCTCCTCGACAGCATCAGTAAGCTTCGGGGGCTTCACCATCGCCACAAGTTCGCCGCCCAGATCCAGCAGCTCAAGAACACCGCCG

Reverse complement sequence

CGGCGGTGTTCTTGAGCTGCTGGATCTGGGCGGCGAACTTGTGGCGATGGTGAAGCCCCCGAAGCTTACTGATGCTGTCGAGGAGGAGCCTCCTGACGCC[A/G]
CCGCCGGCGGAGAATTCGTGGTTGGAGCGGTGGACGAACAGATCTATGCAGTCCTCGATGTCGTAGGCGAGCTCCCGGATCTCCTTTACCCATGCCCTCC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	76.10%	6.60%	0.66%	16.61%	NA
All Indica	2759	83.30%	11.10%	0.11%	5.51%	NA
All Japonica	1512	67.30%	0.30%	1.32%	31.02%	NA
Aus	269	44.20%	0.00%	2.23%	53.53%	NA
Indica I	595	88.60%	7.70%	0.17%	3.53%	NA
Indica II	465	97.40%	1.10%	0.00%	1.51%	NA
Indica III	913	74.00%	19.50%	0.11%	6.35%	NA
Indica Intermediate	786	81.70%	9.80%	0.13%	8.40%	NA
Temperate Japonica	767	68.60%	0.00%	1.56%	29.86%	NA
Tropical Japonica	504	60.90%	1.00%	1.19%	36.90%	NA
Japonica Intermediate	241	76.80%	0.00%	0.83%	22.41%	NA
VI/Aromatic	96	84.40%	0.00%	1.04%	14.58%	NA
Intermediate	90	90.00%	2.20%	1.11%	6.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1107342410	T -> DEL	LOC_Os11g13410.1	N	frameshift_variant	Average:87.643; most accessible tissue: Zhenshan97 flower, score: 94.106	N	N	N	N
vg1107342410	T -> C	LOC_Os11g13410.1	synonymous_variant ; p.Gly103Gly; LOW	synonymous_codon	Average:87.643; most accessible tissue: Zhenshan97 flower, score: 94.106	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg1107342410	T	C	0.06	0.08	0.09	0.04	0.05	0.06

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1107342410	NA	2.64E-06	mr1155	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107342410	NA	3.98E-06	mr1189	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107342410	NA	3.44E-06	mr1269	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107342410	NA	9.50E-06	mr1479	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107342410	NA	1.98E-06	mr1625	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107342410	NA	4.11E-06	mr1677	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107342410	6.10E-06	5.89E-08	mr1725	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107342410	NA	2.27E-07	mr1726	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107342410	NA	2.67E-06	mr1796	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251