| Variant ID: vg1107338652 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 7338652 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CCCAATCTCTATCTCTTCTCTATCTCTATCTCATGTTTCGTTCGTCCATCGAAACAAAAAAAATAGCGAAAAAAATAAAAAAAAAGTCCGACTCCTAGAT[C/T]
CGATTCGCTCTCAGAAACAAAAAAAAAAAAGTCCGACTCTAAATCCGATTCCCCCTTAAAAACGAAAAATAAAACACACCCCTCTCATTTGAGTCCAAGA
TCTTGGACTCAAATGAGAGGGGTGTGTTTTATTTTTCGTTTTTAAGGGGGAATCGGATTTAGAGTCGGACTTTTTTTTTTTTGTTTCTGAGAGCGAATCG[G/A]
ATCTAGGAGTCGGACTTTTTTTTTATTTTTTTCGCTATTTTTTTTGTTTCGATGGACGAACGAAACATGAGATAGAGATAGAGAAGAGATAGAGATTGGG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 76.80% | 6.50% | 0.44% | 16.25% | NA |
| All Indica | 2759 | 83.50% | 10.90% | 0.11% | 5.47% | NA |
| All Japonica | 1512 | 69.00% | 0.30% | 0.79% | 29.83% | NA |
| Aus | 269 | 44.20% | 0.00% | 1.12% | 54.65% | NA |
| Indica I | 595 | 88.70% | 7.60% | 0.00% | 3.70% | NA |
| Indica II | 465 | 97.40% | 1.10% | 0.22% | 1.29% | NA |
| Indica III | 913 | 74.30% | 19.30% | 0.00% | 6.46% | NA |
| Indica Intermediate | 786 | 81.90% | 9.70% | 0.25% | 8.14% | NA |
| Temperate Japonica | 767 | 69.60% | 0.00% | 1.04% | 29.34% | NA |
| Tropical Japonica | 504 | 62.70% | 1.00% | 0.60% | 35.71% | NA |
| Japonica Intermediate | 241 | 80.50% | 0.00% | 0.41% | 19.09% | NA |
| VI/Aromatic | 96 | 84.40% | 0.00% | 1.04% | 14.58% | NA |
| Intermediate | 90 | 90.00% | 2.20% | 2.22% | 5.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1107338652 | C -> T | LOC_Os11g13410.1 | upstream_gene_variant ; 3439.0bp to feature; MODIFIER | silent_mutation | Average:35.332; most accessible tissue: Zhenshan97 flower, score: 82.834 | N | N | N | N |
| vg1107338652 | C -> T | LOC_Os11g13400.1 | downstream_gene_variant ; 2801.0bp to feature; MODIFIER | silent_mutation | Average:35.332; most accessible tissue: Zhenshan97 flower, score: 82.834 | N | N | N | N |
| vg1107338652 | C -> T | LOC_Os11g13400-LOC_Os11g13410 | intergenic_region ; MODIFIER | silent_mutation | Average:35.332; most accessible tissue: Zhenshan97 flower, score: 82.834 | N | N | N | N |
| vg1107338652 | C -> DEL | N | N | silent_mutation | Average:35.332; most accessible tissue: Zhenshan97 flower, score: 82.834 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1107338652 | 2.51E-06 | 6.28E-06 | mr1137 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1107338652 | NA | 4.01E-06 | mr1155 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1107338652 | NA | 5.44E-06 | mr1725 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1107338652 | NA | 3.50E-06 | mr1796 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |