\
| Variant ID: vg1107330914 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 7330914 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
GTCCGTTCTTTACCCACCCGTACTCACCAACCCGTGGGTGAAAAAACCCGTTGATTGAGCCTAAAACTATGAACAATATAAGTCTCAACGACTACTAAAT[C/T]
ATAGTATAAAACTCATTTCACATCTTAAGCATTGTTCAAGTCTACTTATATGAAATTGTTATTTGATTTCTTGATTATGTAATGTGGTTGTATAATTTTA
TAAAATTATACAACCACATTACATAATCAAGAAATCAAATAACAATTTCATATAAGTAGACTTGAACAATGCTTAAGATGTGAAATGAGTTTTATACTAT[G/A]
ATTTAGTAGTCGTTGAGACTTATATTGTTCATAGTTTTAGGCTCAATCAACGGGTTTTTTCACCCACGGGTTGGTGAGTACGGGTGGGTAAAGAACGGAC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 57.30% | 42.00% | 0.40% | 0.30% | NA |
| All Indica | 2759 | 92.40% | 6.70% | 0.43% | 0.43% | NA |
| All Japonica | 1512 | 6.50% | 93.20% | 0.20% | 0.07% | NA |
| Aus | 269 | 4.80% | 95.20% | 0.00% | 0.00% | NA |
| Indica I | 595 | 92.90% | 6.60% | 0.50% | 0.00% | NA |
| Indica II | 465 | 94.80% | 1.90% | 1.08% | 2.15% | NA |
| Indica III | 913 | 96.20% | 3.80% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 86.10% | 13.10% | 0.51% | 0.25% | NA |
| Temperate Japonica | 767 | 3.40% | 96.30% | 0.13% | 0.13% | NA |
| Tropical Japonica | 504 | 10.50% | 89.30% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 8.30% | 91.30% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 0.00% | 100.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 51.10% | 43.30% | 4.44% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1107330914 | C -> T | LOC_Os11g13400.1 | upstream_gene_variant ; 4707.0bp to feature; MODIFIER | silent_mutation | Average:46.364; most accessible tissue: Zhenshan97 panicle, score: 72.468 | N | N | N | N |
| vg1107330914 | C -> T | LOC_Os11g13390.1 | downstream_gene_variant ; 923.0bp to feature; MODIFIER | silent_mutation | Average:46.364; most accessible tissue: Zhenshan97 panicle, score: 72.468 | N | N | N | N |
| vg1107330914 | C -> T | LOC_Os11g12874-LOC_Os11g13390 | intergenic_region ; MODIFIER | silent_mutation | Average:46.364; most accessible tissue: Zhenshan97 panicle, score: 72.468 | N | N | N | N |
| vg1107330914 | C -> DEL | N | N | silent_mutation | Average:46.364; most accessible tissue: Zhenshan97 panicle, score: 72.468 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1107330914 | NA | 7.32E-34 | mr1104 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1107330914 | NA | 1.53E-19 | mr1179 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1107330914 | NA | 4.46E-10 | mr1195 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1107330914 | NA | 6.32E-15 | mr1199 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1107330914 | NA | 1.64E-32 | mr1213 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1107330914 | NA | 6.50E-31 | mr1224 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1107330914 | NA | 6.36E-06 | mr1224 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1107330914 | NA | 1.84E-11 | mr1233 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1107330914 | NA | 2.61E-17 | mr1255 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1107330914 | NA | 3.30E-13 | mr1270 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1107330914 | NA | 1.41E-09 | mr1299 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1107330914 | NA | 4.22E-24 | mr1537 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1107330914 | NA | 5.29E-08 | mr1610 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1107330914 | NA | 1.07E-12 | mr1657 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1107330914 | NA | 7.13E-06 | mr1661 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1107330914 | NA | 1.19E-16 | mr1700 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1107330914 | NA | 5.71E-07 | mr1763 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1107330914 | NA | 1.93E-15 | mr1870 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1107330914 | NA | 1.55E-11 | mr1938 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1107330914 | NA | 2.03E-10 | mr1047_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1107330914 | NA | 2.17E-49 | mr1063_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1107330914 | NA | 2.55E-06 | mr1152_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1107330914 | NA | 3.34E-06 | mr1204_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1107330914 | NA | 9.48E-11 | mr1228_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1107330914 | NA | 2.49E-16 | mr1260_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1107330914 | NA | 1.32E-06 | mr1318_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1107330914 | NA | 2.20E-21 | mr1401_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1107330914 | NA | 3.35E-24 | mr1422_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1107330914 | NA | 2.17E-07 | mr1527_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1107330914 | NA | 3.85E-06 | mr1539_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1107330914 | NA | 8.91E-06 | mr1638_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1107330914 | NA | 7.10E-06 | mr1713_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1107330914 | NA | 4.61E-06 | mr1729_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1107330914 | NA | 5.52E-07 | mr1834_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1107330914 | NA | 2.10E-18 | mr1870_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1107330914 | NA | 3.48E-21 | mr1924_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1107330914 | NA | 1.19E-29 | mr1932_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1107330914 | NA | 7.05E-28 | mr1943_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |