\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1107330914:

Variant ID: vg1107330914 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 7330914
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTCCGTTCTTTACCCACCCGTACTCACCAACCCGTGGGTGAAAAAACCCGTTGATTGAGCCTAAAACTATGAACAATATAAGTCTCAACGACTACTAAAT[C/T]
ATAGTATAAAACTCATTTCACATCTTAAGCATTGTTCAAGTCTACTTATATGAAATTGTTATTTGATTTCTTGATTATGTAATGTGGTTGTATAATTTTA

Reverse complement sequence

TAAAATTATACAACCACATTACATAATCAAGAAATCAAATAACAATTTCATATAAGTAGACTTGAACAATGCTTAAGATGTGAAATGAGTTTTATACTAT[G/A]
ATTTAGTAGTCGTTGAGACTTATATTGTTCATAGTTTTAGGCTCAATCAACGGGTTTTTTCACCCACGGGTTGGTGAGTACGGGTGGGTAAAGAACGGAC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.30% 42.00% 0.40% 0.30% NA
All Indica  2759 92.40% 6.70% 0.43% 0.43% NA
All Japonica  1512 6.50% 93.20% 0.20% 0.07% NA
Aus  269 4.80% 95.20% 0.00% 0.00% NA
Indica I  595 92.90% 6.60% 0.50% 0.00% NA
Indica II  465 94.80% 1.90% 1.08% 2.15% NA
Indica III  913 96.20% 3.80% 0.00% 0.00% NA
Indica Intermediate  786 86.10% 13.10% 0.51% 0.25% NA
Temperate Japonica  767 3.40% 96.30% 0.13% 0.13% NA
Tropical Japonica  504 10.50% 89.30% 0.20% 0.00% NA
Japonica Intermediate  241 8.30% 91.30% 0.41% 0.00% NA
VI/Aromatic  96 0.00% 100.00% 0.00% 0.00% NA
Intermediate  90 51.10% 43.30% 4.44% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1107330914 C -> T LOC_Os11g13400.1 upstream_gene_variant ; 4707.0bp to feature; MODIFIER silent_mutation Average:46.364; most accessible tissue: Zhenshan97 panicle, score: 72.468 N N N N
vg1107330914 C -> T LOC_Os11g13390.1 downstream_gene_variant ; 923.0bp to feature; MODIFIER silent_mutation Average:46.364; most accessible tissue: Zhenshan97 panicle, score: 72.468 N N N N
vg1107330914 C -> T LOC_Os11g12874-LOC_Os11g13390 intergenic_region ; MODIFIER silent_mutation Average:46.364; most accessible tissue: Zhenshan97 panicle, score: 72.468 N N N N
vg1107330914 C -> DEL N N silent_mutation Average:46.364; most accessible tissue: Zhenshan97 panicle, score: 72.468 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1107330914 NA 7.32E-34 mr1104 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107330914 NA 1.53E-19 mr1179 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107330914 NA 4.46E-10 mr1195 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107330914 NA 6.32E-15 mr1199 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107330914 NA 1.64E-32 mr1213 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107330914 NA 6.50E-31 mr1224 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107330914 NA 6.36E-06 mr1224 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107330914 NA 1.84E-11 mr1233 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107330914 NA 2.61E-17 mr1255 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107330914 NA 3.30E-13 mr1270 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107330914 NA 1.41E-09 mr1299 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107330914 NA 4.22E-24 mr1537 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107330914 NA 5.29E-08 mr1610 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107330914 NA 1.07E-12 mr1657 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107330914 NA 7.13E-06 mr1661 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107330914 NA 1.19E-16 mr1700 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107330914 NA 5.71E-07 mr1763 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107330914 NA 1.93E-15 mr1870 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107330914 NA 1.55E-11 mr1938 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107330914 NA 2.03E-10 mr1047_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107330914 NA 2.17E-49 mr1063_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107330914 NA 2.55E-06 mr1152_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107330914 NA 3.34E-06 mr1204_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107330914 NA 9.48E-11 mr1228_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107330914 NA 2.49E-16 mr1260_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107330914 NA 1.32E-06 mr1318_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107330914 NA 2.20E-21 mr1401_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107330914 NA 3.35E-24 mr1422_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107330914 NA 2.17E-07 mr1527_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107330914 NA 3.85E-06 mr1539_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107330914 NA 8.91E-06 mr1638_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107330914 NA 7.10E-06 mr1713_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107330914 NA 4.61E-06 mr1729_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107330914 NA 5.52E-07 mr1834_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107330914 NA 2.10E-18 mr1870_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107330914 NA 3.48E-21 mr1924_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107330914 NA 1.19E-29 mr1932_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107330914 NA 7.05E-28 mr1943_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251