Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1107129860:

Variant ID: vg1107129860 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 7129860
Reference Allele: G	Alternative Allele: T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TAAAATTTTCACACTGTCTCGATTTGGTTTGATCTGTTGGGATTATAATTTGTTTAATAGATTTAACTACAACTTGATATTCTATATATAAGGTTGTATC[G/T]
GAACTATAACCAATATGTTATATTAAATTACCCGAGTTACTTCATCGGCTACAACATAAATCCGTATAATTATTAATTTATCCGATCTTGGTTATAAGCA

Reverse complement sequence

TGCTTATAACCAAGATCGGATAAATTAATAATTATACGGATTTATGTTGTAGCCGATGAAGTAACTCGGGTAATTTAATATAACATATTGGTTATAGTTC[C/A]
GATACAACCTTATATATAGAATATCAAGTTGTAGTTAAATCTATTAAACAAATTATAATCCCAACAGATCAAACCAAATCGAGACAGTGTGAAAATTTTA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	84.00%	15.30%	0.74%	0.00%	NA
All Indica	2759	99.90%	0.10%	0.00%	0.00%	NA
All Japonica	1512	56.00%	41.70%	2.25%	0.00%	NA
Aus	269	94.80%	5.20%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.80%	0.20%	0.00%	0.00%	NA
Indica III	913	99.90%	0.10%	0.00%	0.00%	NA
Indica Intermediate	786	99.70%	0.30%	0.00%	0.00%	NA
Temperate Japonica	767	63.40%	33.40%	3.26%	0.00%	NA
Tropical Japonica	504	50.00%	48.60%	1.39%	0.00%	NA
Japonica Intermediate	241	45.20%	53.90%	0.83%	0.00%	NA
VI/Aromatic	96	34.40%	65.60%	0.00%	0.00%	NA
Intermediate	90	87.80%	11.10%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1107129860	G -> T	LOC_Os11g12650.1	upstream_gene_variant ; 1003.0bp to feature; MODIFIER	silent_mutation	Average:52.16; most accessible tissue: Callus, score: 67.212	N	N	N	N
vg1107129860	G -> T	LOC_Os11g12660.1	upstream_gene_variant ; 3362.0bp to feature; MODIFIER	silent_mutation	Average:52.16; most accessible tissue: Callus, score: 67.212	N	N	N	N
vg1107129860	G -> T	LOC_Os11g12650-LOC_Os11g12660	intergenic_region ; MODIFIER	silent_mutation	Average:52.16; most accessible tissue: Callus, score: 67.212	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1107129860	1.01E-06	NA	mr1672	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251