\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1107093285:

Variant ID: vg1107093285 (JBrowse)Variation Type: INDEL
Chromosome: chr11Position: 7093285
Reference Allele: TAGATGGATACATAGATAGAlternative Allele: AAGATGGATACATAGATAG,T
Primary Allele: TAGATGGATACATAGATAGSecondary Allele: AAGATGGATACATAGATAG

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GAATAATTTCAGATCTTCAGACAAGGAAAGTGACGAGCTGCTGCAAAGCGGCGCCCCTTCCTCCCTCCCCTTGCATGGGACCTCCTGCTGAAGAGAAAGA[TAGATGGATACATAGATAG/AAGATGGATACATAGATAG,T]
AGAGAGAGAGAGAGAGTACACGACCCCAGCTACAAATTAAAGATCCAGAAGCACAGCACCACACTAGTACAATATCTTTCTAGAGAGAGAAACGACAGAG

Reverse complement sequence

CTCTGTCGTTTCTCTCTCTAGAAAGATATTGTACTAGTGTGGTGCTGTGCTTCTGGATCTTTAATTTGTAGCTGGGGTCGTGTACTCTCTCTCTCTCTCT[CTATCTATGTATCCATCTA/CTATCTATGTATCCATCTT,A]
TCTTTCTCTTCAGCAGGAGGTCCCATGCAAGGGGAGGGAGGAAGGGGCGCCGCTTTGCAGCAGCTCGTCACTTTCCTTGTCTGAAGATCTGAAATTATTC

Allele Frequencies:

Populations Population SizeFrequency of TAGATGGATACATAGATAG(primary allele) Frequency of AAGATGGATACATAGATAG(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 71.60% 0.50% 8.68% 19.13% T: 0.11%
All Indica  2759 65.50% 0.00% 7.14% 27.33% NA
All Japonica  1512 92.90% 1.30% 4.76% 1.12% NA
Aus  269 12.60% 0.00% 44.61% 42.38% T: 0.37%
Indica I  595 73.40% 0.20% 9.24% 17.14% NA
Indica II  465 66.00% 0.00% 7.96% 26.02% NA
Indica III  913 62.70% 0.00% 5.81% 31.54% NA
Indica Intermediate  786 62.50% 0.00% 6.62% 30.92% NA
Temperate Japonica  767 89.60% 2.20% 7.82% 0.39% NA
Tropical Japonica  504 97.00% 0.00% 0.99% 1.98% NA
Japonica Intermediate  241 94.60% 0.80% 2.90% 1.66% NA
VI/Aromatic  96 68.80% 3.10% 16.67% 7.29% T: 4.17%
Intermediate  90 78.90% 2.20% 5.56% 13.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1107093285 TAGATGGATACATAGATAG -> T LOC_Os11g12610-LOC_Os11g12620 intergenic_region ; MODIFIER silent_mutation Average:80.39; most accessible tissue: Callus, score: 97.679 N N N N
vg1107093285 TAGATGGATACATAGATAG -> AAGATGGATACATAGATAG LOC_Os11g12610-LOC_Os11g12620 intergenic_region ; MODIFIER silent_mutation Average:80.39; most accessible tissue: Callus, score: 97.679 N N N N
vg1107093285 TAGATGGATACATAGATAG -> DEL N N silent_mutation Average:80.39; most accessible tissue: Callus, score: 97.679 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1107093285 TAGAT* AAGAT* 0.0 -0.01 0.0 0.06 -0.01 -0.03
vg1107093285 TAGAT* T -0.06 0.01 -0.01 -0.06 -0.1 -0.06

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1107093285 NA 3.20E-06 mr1126 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107093285 NA 6.39E-06 mr1305 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107093285 NA 5.45E-06 mr1318 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107093285 NA 2.26E-06 mr1358 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107093285 NA 3.84E-06 mr1380 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107093285 NA 5.75E-06 mr1397 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107093285 NA 5.57E-06 mr1521 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107093285 NA 1.97E-06 mr1576 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107093285 NA 5.93E-07 mr1585 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107093285 NA 7.34E-06 mr1614 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107093285 1.87E-06 4.40E-07 mr1715 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107093285 NA 3.34E-07 mr1788 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107093285 NA 8.57E-06 mr1937 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107093285 1.53E-06 8.38E-09 mr1305_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107093285 7.17E-08 2.42E-07 mr1559_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107093285 8.28E-06 3.92E-10 mr1585_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107093285 3.51E-06 1.13E-07 mr1703_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1107093285 NA 8.40E-06 mr1765_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251