\
| Variant ID: vg1107088655 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 7088655 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TAATTTAGTGTTTAAAATGTTGCTAATTTTTTCTATAAACTTAGTAAAACTTAACAAAGTTTGATTAGAAAAAAGTTAAAACAACTTATGATATAAAACA[G/A]
AGGGAGTATGTACAAAGACAACATGTTAGGGAGGAATTTTTGGAATATATATGAGAGATAGTGAGATGTTTGTCTATGACAAATGTTAATACCGGTGAAA
TTTCACCGGTATTAACATTTGTCATAGACAAACATCTCACTATCTCTCATATATATTCCAAAAATTCCTCCCTAACATGTTGTCTTTGTACATACTCCCT[C/T]
TGTTTTATATCATAAGTTGTTTTAACTTTTTTCTAATCAAACTTTGTTAAGTTTTACTAAGTTTATAGAAAAAATTAGCAACATTTTAAACACTAAATTA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 90.40% | 7.50% | 1.06% | 0.97% | NA |
| All Indica | 2759 | 96.60% | 0.10% | 1.74% | 1.52% | NA |
| All Japonica | 1512 | 80.80% | 19.00% | 0.07% | 0.07% | NA |
| Aus | 269 | 95.20% | 4.80% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.50% | 0.30% | 0.17% | 0.00% | NA |
| Indica II | 465 | 88.40% | 0.00% | 6.67% | 4.95% | NA |
| Indica III | 913 | 99.20% | 0.00% | 0.22% | 0.55% | NA |
| Indica Intermediate | 786 | 96.20% | 0.30% | 1.78% | 1.78% | NA |
| Temperate Japonica | 767 | 75.90% | 23.90% | 0.13% | 0.13% | NA |
| Tropical Japonica | 504 | 86.30% | 13.70% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 85.10% | 14.90% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 54.20% | 45.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 87.80% | 7.80% | 1.11% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1107088655 | G -> A | LOC_Os11g12610.1 | upstream_gene_variant ; 3866.0bp to feature; MODIFIER | silent_mutation | Average:23.813; most accessible tissue: Minghui63 panicle, score: 46.754 | N | N | N | N |
| vg1107088655 | G -> A | LOC_Os11g12610-LOC_Os11g12620 | intergenic_region ; MODIFIER | silent_mutation | Average:23.813; most accessible tissue: Minghui63 panicle, score: 46.754 | N | N | N | N |
| vg1107088655 | G -> DEL | N | N | silent_mutation | Average:23.813; most accessible tissue: Minghui63 panicle, score: 46.754 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1107088655 | NA | 6.54E-08 | mr1585_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1107088655 | NA | 8.87E-07 | mr1585_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1107088655 | 8.96E-07 | 1.46E-08 | mr1693_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |