Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1106870375:

Variant ID: vg1106870375 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 6870375
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CATATTTATGTCCACATCTCATTAAATAACTTCAAACTGAAGATAGTAAATCACAGAGAACATAGATGTTTTAAAGCGTCAAAGACAAAGGGATTAAGGA[C/A]
CTGATATTATTGAGGAAAGCCAATTTGAAACATTACTCCAACAGAAACCAGTGTCCAGGTGCCTTCAGCAAGACAAGATAAATGTGAGAGAATAATCTGA

Reverse complement sequence

TCAGATTATTCTCTCACATTTATCTTGTCTTGCTGAAGGCACCTGGACACTGGTTTCTGTTGGAGTAATGTTTCAAATTGGCTTTCCTCAATAATATCAG[G/T]
TCCTTAATCCCTTTGTCTTTGACGCTTTAAAACATCTATGTTCTCTGTGATTTACTATCTTCAGTTTGAAGTTATTTAATGAGATGTGGACATAAATATG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	41.60%	24.10%	0.53%	33.75%	NA
All Indica	2759	47.90%	2.20%	0.51%	49.37%	NA
All Japonica	1512	21.00%	65.30%	0.60%	13.03%	NA
Aus	269	97.00%	0.40%	0.00%	2.60%	NA
Indica I	595	26.60%	2.00%	0.50%	70.92%	NA
Indica II	465	27.50%	0.60%	0.43%	71.40%	NA
Indica III	913	70.10%	3.20%	0.55%	26.18%	NA
Indica Intermediate	786	50.30%	2.30%	0.51%	46.95%	NA
Temperate Japonica	767	22.00%	73.50%	0.13%	4.30%	NA
Tropical Japonica	504	21.80%	53.80%	0.99%	23.41%	NA
Japonica Intermediate	241	16.20%	63.50%	1.24%	19.09%	NA
VI/Aromatic	96	24.00%	74.00%	0.00%	2.08%	NA
Intermediate	90	46.70%	21.10%	2.22%	30.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1106870375	C -> A	LOC_Os11g12290.1	upstream_gene_variant ; 2490.0bp to feature; MODIFIER	silent_mutation	Average:8.416; most accessible tissue: Callus, score: 45.894	N	N	N	N
vg1106870375	C -> A	LOC_Os11g12300.1	upstream_gene_variant ; 1662.0bp to feature; MODIFIER	silent_mutation	Average:8.416; most accessible tissue: Callus, score: 45.894	N	N	N	N
vg1106870375	C -> A	LOC_Os11g12310.1	downstream_gene_variant ; 3585.0bp to feature; MODIFIER	silent_mutation	Average:8.416; most accessible tissue: Callus, score: 45.894	N	N	N	N
vg1106870375	C -> A	LOC_Os11g12290-LOC_Os11g12300	intergenic_region ; MODIFIER	silent_mutation	Average:8.416; most accessible tissue: Callus, score: 45.894	N	N	N	N
vg1106870375	C -> DEL	N	N	silent_mutation	Average:8.416; most accessible tissue: Callus, score: 45.894	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1106870375	2.58E-06	NA	mr1566_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1106870375	1.39E-07	NA	mr1567_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1106870375	1.15E-06	1.39E-06	mr1567_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1106870375	NA	5.46E-06	mr1693_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1106870375	NA	4.94E-06	mr1785_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1106870375	NA	4.70E-09	mr1947_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251