\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1106632830:

Variant ID: vg1106632830 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 6632830
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 272. )

Flanking Sequence (100 bp) in Reference Genome:


GTCTTAGCTTCTTGATCTTAACAATACTTCGTGGTAGCTTCTCAATTTTGGTTTGCTTGATGTCAAGCGTGTGGAGGTTAGATAACTTTCCAATAGACTC[C/T]
GGAAGTGATTTGACTTTGGTGCGTCGTAAGCCAATGTAACGTAGATTAAACATATTCCCAATAGAAGTCGGCACTTCAGTAATCTCTGAGTCTTGCAGCT

Reverse complement sequence

AGCTGCAAGACTCAGAGATTACTGAAGTGCCGACTTCTATTGGGAATATGTTTAATCTACGTTACATTGGCTTACGACGCACCAAAGTCAAATCACTTCC[G/A]
GAGTCTATTGGAAAGTTATCTAACCTCCACACGCTTGACATCAAGCAAACCAAAATTGAGAAGCTACCACGAAGTATTGTTAAGATCAAGAAGCTAAGAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 86.40% 0.90% 0.93% 11.70% NA
All Indica  2759 83.40% 0.00% 0.94% 15.59% NA
All Japonica  1512 92.70% 2.80% 0.73% 3.77% NA
Aus  269 78.40% 0.00% 2.23% 19.33% NA
Indica I  595 65.70% 0.20% 1.68% 32.44% NA
Indica II  465 93.50% 0.00% 0.00% 6.45% NA
Indica III  913 90.30% 0.00% 0.44% 9.31% NA
Indica Intermediate  786 83.00% 0.00% 1.53% 15.52% NA
Temperate Japonica  767 97.40% 0.10% 0.13% 2.35% NA
Tropical Japonica  504 85.50% 7.90% 1.59% 4.96% NA
Japonica Intermediate  241 92.90% 0.40% 0.83% 5.81% NA
VI/Aromatic  96 92.70% 0.00% 0.00% 7.29% NA
Intermediate  90 90.00% 1.10% 1.11% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1106632830 C -> T LOC_Os11g11950.1 synonymous_variant ; p.Pro598Pro; LOW synonymous_codon Average:50.27; most accessible tissue: Minghui63 flag leaf, score: 88.687 N N N N
vg1106632830 C -> DEL LOC_Os11g11950.1 N frameshift_variant Average:50.27; most accessible tissue: Minghui63 flag leaf, score: 88.687 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1106632830 C T 0.02 0.0 0.0 0.02 0.02 0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1106632830 8.23E-06 9.65E-07 mr1076 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1106632830 NA 7.31E-06 mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1106632830 NA 1.81E-06 mr1227 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1106632830 6.02E-06 5.60E-07 mr1042_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1106632830 4.41E-06 NA mr1742_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1106632830 6.93E-08 1.11E-08 mr1871_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251