\
| Variant ID: vg1106630123 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 6630123 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
ATATAGGCTAAAAAAATAATTAATTGTGCAGATTGCGACTAATTTGCGAGACGAATCTTTTAAGCCTAATTGCTCTATGATTTAACAATGTGGTGCTACA[G/A]
TAAACATTTGCTAATGATGGATTAATTAGGCTTAATAAATTTATCTCGTTGTTTAATGACGGATTCTGTAATTAGTTTTTTATTAGTGCCCGAAACACCC
GGGTGTTTCGGGCACTAATAAAAAACTAATTACAGAATCCGTCATTAAACAACGAGATAAATTTATTAAGCCTAATTAATCCATCATTAGCAAATGTTTA[C/T]
TGTAGCACCACATTGTTAAATCATAGAGCAATTAGGCTTAAAAGATTCGTCTCGCAAATTAGTCGCAATCTGCACAATTAATTATTTTTTTAGCCTATAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 70.80% | 8.20% | 7.96% | 13.10% | NA |
| All Indica | 2759 | 79.70% | 0.20% | 9.46% | 10.58% | NA |
| All Japonica | 1512 | 52.70% | 23.40% | 5.89% | 17.99% | NA |
| Aus | 269 | 79.90% | 0.00% | 5.95% | 14.13% | NA |
| Indica I | 595 | 48.40% | 0.20% | 26.89% | 24.54% | NA |
| Indica II | 465 | 91.60% | 0.00% | 2.58% | 5.81% | NA |
| Indica III | 913 | 91.00% | 0.30% | 2.85% | 5.81% | NA |
| Indica Intermediate | 786 | 83.30% | 0.30% | 8.02% | 8.40% | NA |
| Temperate Japonica | 767 | 50.10% | 19.80% | 6.39% | 23.73% | NA |
| Tropical Japonica | 504 | 62.30% | 25.00% | 4.96% | 7.74% | NA |
| Japonica Intermediate | 241 | 41.10% | 31.50% | 6.22% | 21.16% | NA |
| VI/Aromatic | 96 | 68.80% | 19.80% | 4.17% | 7.29% | NA |
| Intermediate | 90 | 73.30% | 8.90% | 6.67% | 11.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1106630123 | G -> A | LOC_Os11g11940.1 | downstream_gene_variant ; 1110.0bp to feature; MODIFIER | silent_mutation | Average:36.467; most accessible tissue: Minghui63 root, score: 72.134 | N | N | N | N |
| vg1106630123 | G -> A | LOC_Os11g11950.1 | downstream_gene_variant ; 1835.0bp to feature; MODIFIER | silent_mutation | Average:36.467; most accessible tissue: Minghui63 root, score: 72.134 | N | N | N | N |
| vg1106630123 | G -> A | LOC_Os11g11940-LOC_Os11g11950 | intergenic_region ; MODIFIER | silent_mutation | Average:36.467; most accessible tissue: Minghui63 root, score: 72.134 | N | N | N | N |
| vg1106630123 | G -> DEL | N | N | silent_mutation | Average:36.467; most accessible tissue: Minghui63 root, score: 72.134 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1106630123 | NA | 9.19E-08 | mr1084_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1106630123 | 6.19E-06 | NA | mr1591_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1106630123 | 4.88E-06 | NA | mr1702_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1106630123 | 7.33E-06 | NA | mr1890_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1106630123 | 1.61E-06 | NA | mr1902_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |