\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1106620010:

Variant ID: vg1106620010 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 6620010
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.76, T: 0.24, others allele: 0.00, population size: 46. )

Flanking Sequence (100 bp) in Reference Genome:


ATGCTCTAGCCGGGTGTCAGGTGGCGTGCGGTAGGTATGCCCTGTCCCGTCACGATGATGAGGGGTACAACACCTCTCAACTATTCAGCGTTGGCTTGAC[T/C]
GCCTTGAACATACCCGGGATGACATTCCCGGTGCACTAACACCCCAGAATCCACATCCATTAAATGGTGAATGACGGGGATCCTCCCCGTGTCGGCCTGC

Reverse complement sequence

GCAGGCCGACACGGGGAGGATCCCCGTCATTCACCATTTAATGGATGTGGATTCTGGGGTGTTAGTGCACCGGGAATGTCATCCCGGGTATGTTCAAGGC[A/G]
GTCAAGCCAACGCTGAATAGTTGAGAGGTGTTGTACCCCTCATCATCGTGACGGGACAGGGCATACCTACCGCACGCCACCTGACACCCGGCTAGAGCAT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 31.30% 20.20% 1.31% 47.21% NA
All Indica  2759 7.60% 25.40% 1.92% 65.06% NA
All Japonica  1512 76.70% 1.90% 0.33% 21.10% NA
Aus  269 0.40% 72.90% 0.00% 26.77% NA
Indica I  595 7.60% 9.60% 1.34% 81.51% NA
Indica II  465 2.60% 18.90% 1.51% 76.99% NA
Indica III  913 10.30% 38.20% 1.42% 50.05% NA
Indica Intermediate  786 7.50% 26.30% 3.18% 62.98% NA
Temperate Japonica  767 71.10% 1.40% 0.65% 26.86% NA
Tropical Japonica  504 87.10% 1.40% 0.00% 11.51% NA
Japonica Intermediate  241 73.00% 4.10% 0.00% 22.82% NA
VI/Aromatic  96 79.20% 7.30% 1.04% 12.50% NA
Intermediate  90 36.70% 23.30% 3.33% 36.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1106620010 T -> DEL N N silent_mutation Average:12.04; most accessible tissue: Callus, score: 61.735 N N N N
vg1106620010 T -> C LOC_Os11g11920.1 upstream_gene_variant ; 3983.0bp to feature; MODIFIER silent_mutation Average:12.04; most accessible tissue: Callus, score: 61.735 N N N N
vg1106620010 T -> C LOC_Os11g11930.1 upstream_gene_variant ; 1513.0bp to feature; MODIFIER silent_mutation Average:12.04; most accessible tissue: Callus, score: 61.735 N N N N
vg1106620010 T -> C LOC_Os11g11940.1 upstream_gene_variant ; 1632.0bp to feature; MODIFIER silent_mutation Average:12.04; most accessible tissue: Callus, score: 61.735 N N N N
vg1106620010 T -> C LOC_Os11g11930-LOC_Os11g11940 intergenic_region ; MODIFIER silent_mutation Average:12.04; most accessible tissue: Callus, score: 61.735 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1106620010 NA 2.53E-09 mr1336 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1106620010 3.48E-06 7.44E-07 mr1790 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251