Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1106573600:

Variant ID: vg1106573600 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 6573600
Reference Allele: T	Alternative Allele: A,C
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AGGAAAAGCCAAAGACGCCCGCCCCATTACCTCCGGAGACGGGTGGAAAATCCATGAACTGAATCGAAAGGAGATACGGTCTTGCACGTCGGACTTTAAA[T/A,C]
GACGCGACCTTCGCCAACAGGTAAATTGGTATGTATCCGCATATTTGTTTTCAACAATTTGAATTTTTGCATCATCACATATTTGAATTTCAAAATTACA

Reverse complement sequence

TGTAATTTTGAAATTCAAATATGTGATGATGCAAAAATTCAAATTGTTGAAAACAAATATGCGGATACATACCAATTTACCTGTTGGCGAAGGTCGCGTC[A/T,G]
TTTAAAGTCCGACGTGCAAGACCGTATCTCCTTTCGATTCAGTTCATGGATTTTCCACCCGTCTCCGGAGGTAATGGGGCGGGCGTCTTTGGCTTTTCCT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	80.80%	14.80%	1.35%	2.31%	C: 0.74%
All Indica	2759	89.80%	8.40%	0.51%	0.00%	C: 1.27%
All Japonica	1512	63.30%	26.20%	3.31%	7.21%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	91.80%	6.70%	0.50%	0.00%	C: 1.01%
Indica II	465	94.20%	3.20%	1.29%	0.00%	C: 1.29%
Indica III	913	84.70%	13.60%	0.22%	0.00%	C: 1.53%
Indica Intermediate	786	91.60%	6.90%	0.38%	0.00%	C: 1.15%
Temperate Japonica	767	62.70%	21.40%	3.65%	12.26%	NA
Tropical Japonica	504	61.50%	36.10%	1.79%	0.60%	NA
Japonica Intermediate	241	68.90%	20.70%	5.39%	4.98%	NA
VI/Aromatic	96	43.80%	56.20%	0.00%	0.00%	NA
Intermediate	90	80.00%	20.00%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1106573600	T -> A	LOC_Os11g11830.1	upstream_gene_variant ; 4106.0bp to feature; MODIFIER	silent_mutation	Average:16.871; most accessible tissue: Minghui63 root, score: 23.574	N	N	N	N
vg1106573600	T -> A	LOC_Os11g11850.1	upstream_gene_variant ; 683.0bp to feature; MODIFIER	silent_mutation	Average:16.871; most accessible tissue: Minghui63 root, score: 23.574	N	N	N	N
vg1106573600	T -> A	LOC_Os11g11840.1	downstream_gene_variant ; 39.0bp to feature; MODIFIER	silent_mutation	Average:16.871; most accessible tissue: Minghui63 root, score: 23.574	N	N	N	N
vg1106573600	T -> A	LOC_Os11g11840-LOC_Os11g11850	intergenic_region ; MODIFIER	silent_mutation	Average:16.871; most accessible tissue: Minghui63 root, score: 23.574	N	N	N	N
vg1106573600	T -> DEL	N	N	silent_mutation	Average:16.871; most accessible tissue: Minghui63 root, score: 23.574	N	N	N	N
vg1106573600	T -> C	LOC_Os11g11830.1	upstream_gene_variant ; 4106.0bp to feature; MODIFIER	silent_mutation	Average:16.871; most accessible tissue: Minghui63 root, score: 23.574	N	N	N	N
vg1106573600	T -> C	LOC_Os11g11850.1	upstream_gene_variant ; 683.0bp to feature; MODIFIER	silent_mutation	Average:16.871; most accessible tissue: Minghui63 root, score: 23.574	N	N	N	N
vg1106573600	T -> C	LOC_Os11g11840.1	downstream_gene_variant ; 39.0bp to feature; MODIFIER	silent_mutation	Average:16.871; most accessible tissue: Minghui63 root, score: 23.574	N	N	N	N
vg1106573600	T -> C	LOC_Os11g11840-LOC_Os11g11850	intergenic_region ; MODIFIER	silent_mutation	Average:16.871; most accessible tissue: Minghui63 root, score: 23.574	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1106573600	3.48E-06	NA	mr1162_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251