\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1106573600:

Variant ID: vg1106573600 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 6573600
Reference Allele: TAlternative Allele: A,C
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGGAAAAGCCAAAGACGCCCGCCCCATTACCTCCGGAGACGGGTGGAAAATCCATGAACTGAATCGAAAGGAGATACGGTCTTGCACGTCGGACTTTAAA[T/A,C]
GACGCGACCTTCGCCAACAGGTAAATTGGTATGTATCCGCATATTTGTTTTCAACAATTTGAATTTTTGCATCATCACATATTTGAATTTCAAAATTACA

Reverse complement sequence

TGTAATTTTGAAATTCAAATATGTGATGATGCAAAAATTCAAATTGTTGAAAACAAATATGCGGATACATACCAATTTACCTGTTGGCGAAGGTCGCGTC[A/T,G]
TTTAAAGTCCGACGTGCAAGACCGTATCTCCTTTCGATTCAGTTCATGGATTTTCCACCCGTCTCCGGAGGTAATGGGGCGGGCGTCTTTGGCTTTTCCT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 80.80% 14.80% 1.35% 2.31% C: 0.74%
All Indica  2759 89.80% 8.40% 0.51% 0.00% C: 1.27%
All Japonica  1512 63.30% 26.20% 3.31% 7.21% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 91.80% 6.70% 0.50% 0.00% C: 1.01%
Indica II  465 94.20% 3.20% 1.29% 0.00% C: 1.29%
Indica III  913 84.70% 13.60% 0.22% 0.00% C: 1.53%
Indica Intermediate  786 91.60% 6.90% 0.38% 0.00% C: 1.15%
Temperate Japonica  767 62.70% 21.40% 3.65% 12.26% NA
Tropical Japonica  504 61.50% 36.10% 1.79% 0.60% NA
Japonica Intermediate  241 68.90% 20.70% 5.39% 4.98% NA
VI/Aromatic  96 43.80% 56.20% 0.00% 0.00% NA
Intermediate  90 80.00% 20.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1106573600 T -> A LOC_Os11g11830.1 upstream_gene_variant ; 4106.0bp to feature; MODIFIER silent_mutation Average:16.871; most accessible tissue: Minghui63 root, score: 23.574 N N N N
vg1106573600 T -> A LOC_Os11g11850.1 upstream_gene_variant ; 683.0bp to feature; MODIFIER silent_mutation Average:16.871; most accessible tissue: Minghui63 root, score: 23.574 N N N N
vg1106573600 T -> A LOC_Os11g11840.1 downstream_gene_variant ; 39.0bp to feature; MODIFIER silent_mutation Average:16.871; most accessible tissue: Minghui63 root, score: 23.574 N N N N
vg1106573600 T -> A LOC_Os11g11840-LOC_Os11g11850 intergenic_region ; MODIFIER silent_mutation Average:16.871; most accessible tissue: Minghui63 root, score: 23.574 N N N N
vg1106573600 T -> DEL N N silent_mutation Average:16.871; most accessible tissue: Minghui63 root, score: 23.574 N N N N
vg1106573600 T -> C LOC_Os11g11830.1 upstream_gene_variant ; 4106.0bp to feature; MODIFIER silent_mutation Average:16.871; most accessible tissue: Minghui63 root, score: 23.574 N N N N
vg1106573600 T -> C LOC_Os11g11850.1 upstream_gene_variant ; 683.0bp to feature; MODIFIER silent_mutation Average:16.871; most accessible tissue: Minghui63 root, score: 23.574 N N N N
vg1106573600 T -> C LOC_Os11g11840.1 downstream_gene_variant ; 39.0bp to feature; MODIFIER silent_mutation Average:16.871; most accessible tissue: Minghui63 root, score: 23.574 N N N N
vg1106573600 T -> C LOC_Os11g11840-LOC_Os11g11850 intergenic_region ; MODIFIER silent_mutation Average:16.871; most accessible tissue: Minghui63 root, score: 23.574 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1106573600 3.48E-06 NA mr1162_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251