\
| Variant ID: vg1106566073 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 6566073 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.66, A: 0.34, others allele: 0.00, population size: 59. )
AGTGATAGGCACGATATTGCTCTCATTAACTTCAGATAGACCAGGCTTCTAGATCTTAAATTTAGAAGAGCCATCTTTACCAGCTGAAGACGGCGATGCT[G/A]
GTGGTTTCTCAGCCATGGGAAAATGCTGTTGTGATTCTGACTTCTAATAGTCCCATCGGGTGTGCCAAAAGCGTGTTGATGTGAAAACACGAGGCCTGGG
CCCAGGCCTCGTGTTTTCACATCAACACGCTTTTGGCACACCCGATGGGACTATTAGAAGTCAGAATCACAACAGCATTTTCCCATGGCTGAGAAACCAC[C/T]
AGCATCGCCGTCTTCAGCTGGTAAAGATGGCTCTTCTAAATTTAAGATCTAGAAGCCTGGTCTATCTGAAGTTAATGAGAGCAATATCGTGCCTATCACT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 50.10% | 34.70% | 3.75% | 11.49% | NA |
| All Indica | 2759 | 33.30% | 54.50% | 4.35% | 7.87% | NA |
| All Japonica | 1512 | 76.90% | 3.00% | 2.31% | 17.79% | NA |
| Aus | 269 | 59.50% | 24.50% | 5.20% | 10.78% | NA |
| Indica I | 595 | 28.70% | 62.70% | 5.04% | 3.53% | NA |
| Indica II | 465 | 24.50% | 66.90% | 4.52% | 4.09% | NA |
| Indica III | 913 | 41.00% | 42.80% | 3.29% | 12.92% | NA |
| Indica Intermediate | 786 | 33.10% | 54.50% | 4.96% | 7.51% | NA |
| Temperate Japonica | 767 | 72.60% | 2.60% | 2.61% | 22.16% | NA |
| Tropical Japonica | 504 | 82.90% | 3.80% | 1.98% | 11.31% | NA |
| Japonica Intermediate | 241 | 77.60% | 2.90% | 2.07% | 17.43% | NA |
| VI/Aromatic | 96 | 66.70% | 9.40% | 3.12% | 20.83% | NA |
| Intermediate | 90 | 68.90% | 16.70% | 5.56% | 8.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1106566073 | G -> A | LOC_Os11g11820.1 | missense_variant ; p.Pro6Leu; MODERATE | nonsynonymous_codon ; P6L | Average:31.096; most accessible tissue: Zhenshan97 panicle, score: 46.362 | unknown | unknown | DELETERIOUS | 0.00 |
| vg1106566073 | G -> DEL | LOC_Os11g11820.1 | N | frameshift_variant | Average:31.096; most accessible tissue: Zhenshan97 panicle, score: 46.362 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1106566073 | NA | 5.40E-08 | mr1084_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1106566073 | NA | 3.77E-07 | mr1205_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1106566073 | NA | 3.57E-07 | mr1302_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1106566073 | NA | 5.30E-08 | mr1376_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1106566073 | NA | 4.58E-06 | mr1407_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1106566073 | NA | 2.53E-08 | mr1431_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1106566073 | NA | 3.69E-08 | mr1604_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1106566073 | NA | 2.20E-08 | mr1659_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1106566073 | 5.04E-06 | 5.04E-06 | mr1670_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1106566073 | NA | 4.13E-08 | mr1824_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1106566073 | NA | 2.39E-07 | mr1869_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1106566073 | NA | 2.30E-06 | mr1878_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |