\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1106552757:

Variant ID: vg1106552757 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 6552757
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.68, T: 0.32, others allele: 0.00, population size: 41. )

Flanking Sequence (100 bp) in Reference Genome:


TATGCAACCCCTCTAGACTACGCTTATAACATAAGGGTTGCATAACACGTTCTCACTACGACATTCTACCGAAGACCGAGAGAGAATAACTTTGTGTCTC[T/C]
ACTTTTTCAGATATTATGCAACCCCTATAGACTACGCTTATAGCATAAGGGTTGCATAACACGTTCTCACTACGATATTCTACCGAAGACCGAGAGAGAA

Reverse complement sequence

TTCTCTCTCGGTCTTCGGTAGAATATCGTAGTGAGAACGTGTTATGCAACCCTTATGCTATAAGCGTAGTCTATAGGGGTTGCATAATATCTGAAAAAGT[A/G]
GAGACACAAAGTTATTCTCTCTCGGTCTTCGGTAGAATGTCGTAGTGAGAACGTGTTATGCAACCCTTATGTTATAAGCGTAGTCTAGAGGGGTTGCATA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 36.10% 17.60% 0.49% 45.83% NA
All Indica  2759 35.40% 3.40% 0.36% 60.78% NA
All Japonica  1512 28.60% 45.40% 0.66% 25.33% NA
Aus  269 72.90% 3.70% 0.74% 22.68% NA
Indica I  595 20.50% 6.60% 0.34% 72.61% NA
Indica II  465 22.80% 3.00% 0.00% 74.19% NA
Indica III  913 52.10% 1.00% 0.44% 46.44% NA
Indica Intermediate  786 34.90% 4.10% 0.51% 60.56% NA
Temperate Japonica  767 23.50% 48.80% 0.91% 26.86% NA
Tropical Japonica  504 38.30% 38.70% 0.40% 22.62% NA
Japonica Intermediate  241 24.50% 49.00% 0.41% 26.14% NA
VI/Aromatic  96 66.70% 20.80% 0.00% 12.50% NA
Intermediate  90 37.80% 24.40% 1.11% 36.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1106552757 T -> DEL N N silent_mutation Average:11.986; most accessible tissue: Callus, score: 78.785 N N N N
vg1106552757 T -> C LOC_Os11g11800.1 upstream_gene_variant ; 3416.0bp to feature; MODIFIER silent_mutation Average:11.986; most accessible tissue: Callus, score: 78.785 N N N N
vg1106552757 T -> C LOC_Os11g11810.1 upstream_gene_variant ; 1757.0bp to feature; MODIFIER silent_mutation Average:11.986; most accessible tissue: Callus, score: 78.785 N N N N
vg1106552757 T -> C LOC_Os11g11800-LOC_Os11g11810 intergenic_region ; MODIFIER silent_mutation Average:11.986; most accessible tissue: Callus, score: 78.785 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1106552757 NA 1.20E-06 mr1184_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1106552757 NA 2.63E-07 mr1278_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1106552757 8.66E-06 8.65E-06 mr1286_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1106552757 6.32E-06 6.32E-06 mr1311_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1106552757 NA 1.11E-07 mr1329_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1106552757 4.38E-06 2.95E-07 mr1337_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1106552757 3.11E-06 1.96E-08 mr1524_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1106552757 NA 5.40E-08 mr1683_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1106552757 NA 1.57E-06 mr1687_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1106552757 6.42E-06 6.40E-06 mr1760_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1106552757 NA 6.79E-06 mr1812_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1106552757 NA 1.54E-06 mr1965_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1106552757 2.51E-06 1.96E-08 mr1982_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251