\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1106552685:

Variant ID: vg1106552685 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 6552685
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.82, A: 0.16, others allele: 0.00, population size: 45. )

Flanking Sequence (100 bp) in Reference Genome:


CACTTGAAGATGAAATGATGAGTTGGAATGTTGCCTCTCTACATATCTTTGTGTTTCCACTTTTTCAGACATTATGCAACCCCTCTAGACTACGCTTATA[A/G]
CATAAGGGTTGCATAACACGTTCTCACTACGACATTCTACCGAAGACCGAGAGAGAATAACTTTGTGTCTCTACTTTTTCAGATATTATGCAACCCCTAT

Reverse complement sequence

ATAGGGGTTGCATAATATCTGAAAAAGTAGAGACACAAAGTTATTCTCTCTCGGTCTTCGGTAGAATGTCGTAGTGAGAACGTGTTATGCAACCCTTATG[T/C]
TATAAGCGTAGTCTAGAGGGGTTGCATAATGTCTGAAAAAGTGGAAACACAAAGATATGTAGAGAGGCAACATTCCAACTCATCATTTCATCTTCAAGTG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 36.10% 17.60% 0.47% 45.90% NA
All Indica  2759 35.50% 3.40% 0.40% 60.75% NA
All Japonica  1512 28.50% 45.30% 0.60% 25.60% NA
Aus  269 73.20% 3.30% 0.37% 23.05% NA
Indica I  595 20.70% 6.70% 0.34% 72.27% NA
Indica II  465 23.00% 3.00% 0.43% 73.55% NA
Indica III  913 52.10% 0.80% 0.33% 46.77% NA
Indica Intermediate  786 34.70% 4.10% 0.51% 60.69% NA
Temperate Japonica  767 23.60% 48.50% 0.65% 27.25% NA
Tropical Japonica  504 37.90% 39.10% 0.40% 22.62% NA
Japonica Intermediate  241 24.50% 48.10% 0.83% 26.56% NA
VI/Aromatic  96 66.70% 20.80% 0.00% 12.50% NA
Intermediate  90 37.80% 25.60% 1.11% 35.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1106552685 A -> DEL N N silent_mutation Average:18.525; most accessible tissue: Callus, score: 78.785 N N N N
vg1106552685 A -> G LOC_Os11g11800.1 upstream_gene_variant ; 3344.0bp to feature; MODIFIER silent_mutation Average:18.525; most accessible tissue: Callus, score: 78.785 N N N N
vg1106552685 A -> G LOC_Os11g11810.1 upstream_gene_variant ; 1829.0bp to feature; MODIFIER silent_mutation Average:18.525; most accessible tissue: Callus, score: 78.785 N N N N
vg1106552685 A -> G LOC_Os11g11800-LOC_Os11g11810 intergenic_region ; MODIFIER silent_mutation Average:18.525; most accessible tissue: Callus, score: 78.785 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1106552685 NA 1.38E-07 mr1030_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1106552685 NA 6.94E-07 mr1184_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1106552685 NA 2.40E-07 mr1278_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1106552685 NA 9.44E-06 mr1284_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1106552685 5.78E-06 5.77E-06 mr1286_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1106552685 5.41E-06 5.41E-06 mr1311_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1106552685 NA 6.16E-08 mr1329_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1106552685 5.82E-06 3.61E-07 mr1337_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1106552685 2.41E-06 1.29E-08 mr1524_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1106552685 NA 4.86E-08 mr1683_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1106552685 NA 1.75E-06 mr1687_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1106552685 NA 1.09E-06 mr1754_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1106552685 9.54E-06 9.50E-06 mr1760_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1106552685 NA 6.32E-06 mr1812_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1106552685 NA 6.65E-07 mr1965_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1106552685 2.09E-06 1.65E-08 mr1982_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251