\
| Variant ID: vg1106552386 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 6552386 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.90, A: 0.11, others allele: 0.00, population size: 38. )
CAAAAAATTCCTCAGAGCTTTCAAACCAGGACTAAAGATGTTTTTAGTCCCGGTTTTTAATACAACCGGGACTATTGTGAAATCTGGTGGACCGACCAAA[A/G]
ATGGTTTCTCCACCAGTGTTTGCTTCTCCTTTTATCTTAACGTAAGAGAGATGTATTCCTTGTAATTTCTATTTCAGTTTAGTGGAATTATAATCGCAGG
CCTGCGATTATAATTCCACTAAACTGAAATAGAAATTACAAGGAATACATCTCTCTTACGTTAAGATAAAAGGAGAAGCAAACACTGGTGGAGAAACCAT[T/C]
TTTGGTCGGTCCACCAGATTTCACAATAGTCCCGGTTGTATTAAAAACCGGGACTAAAAACATCTTTAGTCCTGGTTTGAAAGCTCTGAGGAATTTTTTG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 36.30% | 18.40% | 1.02% | 44.33% | NA |
| All Indica | 2759 | 35.60% | 3.70% | 1.09% | 59.55% | NA |
| All Japonica | 1512 | 28.70% | 46.80% | 0.73% | 23.74% | NA |
| Aus | 269 | 74.30% | 2.60% | 2.23% | 20.82% | NA |
| Indica I | 595 | 20.80% | 6.10% | 0.84% | 72.27% | NA |
| Indica II | 465 | 23.00% | 3.00% | 0.43% | 73.55% | NA |
| Indica III | 913 | 52.10% | 0.90% | 1.53% | 45.45% | NA |
| Indica Intermediate | 786 | 35.10% | 5.70% | 1.15% | 58.02% | NA |
| Temperate Japonica | 767 | 23.70% | 50.70% | 0.91% | 24.64% | NA |
| Tropical Japonica | 504 | 38.30% | 39.10% | 0.79% | 21.83% | NA |
| Japonica Intermediate | 241 | 24.50% | 50.60% | 0.00% | 24.90% | NA |
| VI/Aromatic | 96 | 66.70% | 30.20% | 0.00% | 3.12% | NA |
| Intermediate | 90 | 37.80% | 23.30% | 1.11% | 37.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1106552386 | A -> DEL | N | N | silent_mutation | Average:15.314; most accessible tissue: Callus, score: 28.821 | N | N | N | N |
| vg1106552386 | A -> G | LOC_Os11g11800.1 | upstream_gene_variant ; 3045.0bp to feature; MODIFIER | silent_mutation | Average:15.314; most accessible tissue: Callus, score: 28.821 | N | N | N | N |
| vg1106552386 | A -> G | LOC_Os11g11810.1 | upstream_gene_variant ; 2128.0bp to feature; MODIFIER | silent_mutation | Average:15.314; most accessible tissue: Callus, score: 28.821 | N | N | N | N |
| vg1106552386 | A -> G | LOC_Os11g11800-LOC_Os11g11810 | intergenic_region ; MODIFIER | silent_mutation | Average:15.314; most accessible tissue: Callus, score: 28.821 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1106552386 | NA | 2.53E-06 | mr1278_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1106552386 | 6.33E-06 | 6.32E-06 | mr1311_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1106552386 | NA | 5.26E-07 | mr1329_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1106552386 | 6.86E-06 | 5.29E-07 | mr1337_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1106552386 | NA | 4.55E-07 | mr1524_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1106552386 | 9.72E-06 | 9.72E-06 | mr1697_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1106552386 | NA | 5.52E-06 | mr1965_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1106552386 | 1.70E-06 | 2.37E-08 | mr1982_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |