Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1106552386:

Variant ID: vg1106552386 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 6552386
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.90, A: 0.11, others allele: 0.00, population size: 38. )

Flanking Sequence (100 bp) in Reference Genome:

CAAAAAATTCCTCAGAGCTTTCAAACCAGGACTAAAGATGTTTTTAGTCCCGGTTTTTAATACAACCGGGACTATTGTGAAATCTGGTGGACCGACCAAA[A/G]
ATGGTTTCTCCACCAGTGTTTGCTTCTCCTTTTATCTTAACGTAAGAGAGATGTATTCCTTGTAATTTCTATTTCAGTTTAGTGGAATTATAATCGCAGG

Reverse complement sequence

CCTGCGATTATAATTCCACTAAACTGAAATAGAAATTACAAGGAATACATCTCTCTTACGTTAAGATAAAAGGAGAAGCAAACACTGGTGGAGAAACCAT[T/C]
TTTGGTCGGTCCACCAGATTTCACAATAGTCCCGGTTGTATTAAAAACCGGGACTAAAAACATCTTTAGTCCTGGTTTGAAAGCTCTGAGGAATTTTTTG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	36.30%	18.40%	1.02%	44.33%	NA
All Indica	2759	35.60%	3.70%	1.09%	59.55%	NA
All Japonica	1512	28.70%	46.80%	0.73%	23.74%	NA
Aus	269	74.30%	2.60%	2.23%	20.82%	NA
Indica I	595	20.80%	6.10%	0.84%	72.27%	NA
Indica II	465	23.00%	3.00%	0.43%	73.55%	NA
Indica III	913	52.10%	0.90%	1.53%	45.45%	NA
Indica Intermediate	786	35.10%	5.70%	1.15%	58.02%	NA
Temperate Japonica	767	23.70%	50.70%	0.91%	24.64%	NA
Tropical Japonica	504	38.30%	39.10%	0.79%	21.83%	NA
Japonica Intermediate	241	24.50%	50.60%	0.00%	24.90%	NA
VI/Aromatic	96	66.70%	30.20%	0.00%	3.12%	NA
Intermediate	90	37.80%	23.30%	1.11%	37.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1106552386	A -> DEL	N	N	silent_mutation	Average:15.314; most accessible tissue: Callus, score: 28.821	N	N	N	N
vg1106552386	A -> G	LOC_Os11g11800.1	upstream_gene_variant ; 3045.0bp to feature; MODIFIER	silent_mutation	Average:15.314; most accessible tissue: Callus, score: 28.821	N	N	N	N
vg1106552386	A -> G	LOC_Os11g11810.1	upstream_gene_variant ; 2128.0bp to feature; MODIFIER	silent_mutation	Average:15.314; most accessible tissue: Callus, score: 28.821	N	N	N	N
vg1106552386	A -> G	LOC_Os11g11800-LOC_Os11g11810	intergenic_region ; MODIFIER	silent_mutation	Average:15.314; most accessible tissue: Callus, score: 28.821	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1106552386	NA	2.53E-06	mr1278_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1106552386	6.33E-06	6.32E-06	mr1311_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1106552386	NA	5.26E-07	mr1329_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1106552386	6.86E-06	5.29E-07	mr1337_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1106552386	NA	4.55E-07	mr1524_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1106552386	9.72E-06	9.72E-06	mr1697_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1106552386	NA	5.52E-06	mr1965_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1106552386	1.70E-06	2.37E-08	mr1982_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251