\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1106481643:

Variant ID: vg1106481643 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 6481643
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGCGACCTCGGTGCGAGGAGGAGCTGCCGGTGGGTGTGGCGCGGTCTTCGGCGCATGAAGACTGGCTGGCGGAGGACGCCGGTGCAGGGGTCCCGCATGT[C/T]
GGCAGAGCTGGAGAGGTGGTGGAGCATCGGTGCATCAGCCAAGGACATCTTGTCTGTGTTCCTTTGTTAGTCCAGCGGCGGTCGGTCACGCTTAGCGGCG

Reverse complement sequence

CGCCGCTAAGCGTGACCGACCGCCGCTGGACTAACAAAGGAACACAGACAAGATGTCCTTGGCTGATGCACCGATGCTCCACCACCTCTCCAGCTCTGCC[G/A]
ACATGCGGGACCCCTGCACCGGCGTCCTCCGCCAGCCAGTCTTCATGCGCCGAAGACCGCGCCACACCCACCGGCAGCTCCTCCTCGCACCGAGGTCGCC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 86.70% 10.60% 0.72% 1.95% NA
All Indica  2759 86.60% 9.20% 0.94% 3.23% NA
All Japonica  1512 99.60% 0.40% 0.00% 0.00% NA
Aus  269 11.90% 86.20% 1.86% 0.00% NA
Indica I  595 93.10% 2.50% 0.34% 4.03% NA
Indica II  465 95.50% 3.20% 0.22% 1.08% NA
Indica III  913 80.20% 14.60% 0.99% 4.27% NA
Indica Intermediate  786 83.80% 11.70% 1.78% 2.67% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 99.40% 0.60% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 93.80% 5.20% 1.04% 0.00% NA
Intermediate  90 90.00% 4.40% 2.22% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1106481643 C -> T LOC_Os11g11660.1 synonymous_variant ; p.Val308Val; LOW synonymous_codon Average:81.816; most accessible tissue: Minghui63 flag leaf, score: 94.147 N N N N
vg1106481643 C -> DEL LOC_Os11g11660.1 N frameshift_variant Average:81.816; most accessible tissue: Minghui63 flag leaf, score: 94.147 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1106481643 C T -0.01 -0.02 -0.01 0.0 -0.01 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1106481643 NA 1.40E-06 mr1126 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1106481643 NA 5.35E-07 mr1286 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1106481643 NA 1.14E-07 mr1420 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1106481643 NA 8.88E-09 mr1465 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1106481643 NA 2.36E-18 mr1515 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1106481643 NA 4.05E-06 mr1545 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1106481643 NA 2.31E-09 mr1556 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1106481643 NA 1.03E-06 mr1621 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1106481643 NA 1.46E-07 mr1665 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1106481643 NA 5.60E-07 mr1706 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1106481643 NA 1.52E-09 mr1730 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1106481643 NA 7.63E-08 mr1735 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1106481643 NA 2.24E-08 mr1764 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1106481643 NA 3.15E-06 mr1774 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1106481643 NA 1.24E-08 mr1866 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1106481643 NA 8.11E-06 mr1976 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251