Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1106434198:

Variant ID: vg1106434198 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 6434198
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TATTGTATAAGAAACATGCTCTAGGTAAACATAATAAATTGTAGATCTGACAACGCTGTATGATCTGAATTGGTACGATAAATTGCAGATAAAATTTTGC[G/A]
TACCATTGTAGATACATGCCGGATGTATCTACGAAATTAGTAGATCAACTTGAAAAACCAATCTACCAATTACCCTGATTAGGCTTGGTAGTCGGTCTGG

Reverse complement sequence

CCAGACCGACTACCAAGCCTAATCAGGGTAATTGGTAGATTGGTTTTTCAAGTTGATCTACTAATTTCGTAGATACATCCGGCATGTATCTACAATGGTA[C/T]
GCAAAATTTTATCTGCAATTTATCGTACCAATTCAGATCATACAGCGTTGTCAGATCTACAATTTATTATGTTTACCTAGAGCATGTTTCTTATACAATA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	35.70%	1.00%	11.19%	52.07%	NA
All Indica	2759	11.90%	0.00%	10.98%	77.09%	NA
All Japonica	1512	79.30%	3.00%	2.58%	15.08%	NA
Aus	269	12.60%	0.00%	64.31%	23.05%	NA
Indica I	595	13.40%	0.20%	18.99%	67.39%	NA
Indica II	465	6.50%	0.00%	5.38%	88.17%	NA
Indica III	913	10.80%	0.00%	5.91%	83.24%	NA
Indica Intermediate	786	15.10%	0.00%	14.12%	70.74%	NA
Temperate Japonica	767	87.10%	2.70%	3.52%	6.65%	NA
Tropical Japonica	504	72.00%	0.20%	0.99%	26.79%	NA
Japonica Intermediate	241	69.70%	10.00%	2.90%	17.43%	NA
VI/Aromatic	96	91.70%	0.00%	6.25%	2.08%	NA
Intermediate	90	44.40%	0.00%	8.89%	46.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1106434198	G -> A	LOC_Os11g11560.1	upstream_gene_variant ; 3315.0bp to feature; MODIFIER	silent_mutation	Average:15.187; most accessible tissue: Callus, score: 70.41	N	N	N	N
vg1106434198	G -> A	LOC_Os11g11570.1	downstream_gene_variant ; 858.0bp to feature; MODIFIER	silent_mutation	Average:15.187; most accessible tissue: Callus, score: 70.41	N	N	N	N
vg1106434198	G -> A	LOC_Os11g11560-LOC_Os11g11570	intergenic_region ; MODIFIER	silent_mutation	Average:15.187; most accessible tissue: Callus, score: 70.41	N	N	N	N
vg1106434198	G -> DEL	N	N	silent_mutation	Average:15.187; most accessible tissue: Callus, score: 70.41	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1106434198	2.19E-08	2.19E-08	mr1191_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251