| Variant ID: vg1106425390 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 6425390 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
AGCTGATACCTAGGTATCAAGCCTTGGTACCTTGGTATCAGGCCTTGGTACCTGGGTATCGACTGATACCTAGTACCCTAGGTATCGAGCTGATACCTAG[G/A]
CATGGTATACCATATGCATGGTATCAGGTATCAGATGCCTAGTACCTAGGTACCATCCATGGGTACCATGTGCATGGTATCAGATACCAGATACCTATAA
TTATAGGTATCTGGTATCTGATACCATGCACATGGTACCCATGGATGGTACCTAGGTACTAGGCATCTGATACCTGATACCATGCATATGGTATACCATG[C/T]
CTAGGTATCAGCTCGATACCTAGGGTACTAGGTATCAGTCGATACCCAGGTACCAAGGCCTGATACCAAGGTACCAAGGCTTGATACCTAGGTATCAGCT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 86.20% | 2.80% | 6.81% | 4.19% | NA |
| All Indica | 2759 | 89.30% | 1.40% | 8.01% | 1.30% | NA |
| All Japonica | 1512 | 87.80% | 0.50% | 1.65% | 10.12% | NA |
| Aus | 269 | 40.50% | 31.60% | 27.88% | 0.00% | NA |
| Indica I | 595 | 94.30% | 0.20% | 3.87% | 1.68% | NA |
| Indica II | 465 | 96.80% | 0.40% | 1.51% | 1.29% | NA |
| Indica III | 913 | 81.90% | 2.60% | 15.44% | 0.00% | NA |
| Indica Intermediate | 786 | 89.70% | 1.40% | 6.36% | 2.54% | NA |
| Temperate Japonica | 767 | 95.00% | 0.00% | 0.39% | 4.56% | NA |
| Tropical Japonica | 504 | 77.60% | 1.40% | 4.37% | 16.67% | NA |
| Japonica Intermediate | 241 | 85.90% | 0.00% | 0.00% | 14.11% | NA |
| VI/Aromatic | 96 | 99.00% | 0.00% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 86.70% | 3.30% | 0.00% | 10.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1106425390 | G -> A | LOC_Os11g11550.1 | upstream_gene_variant ; 1040.0bp to feature; MODIFIER | silent_mutation | Average:27.673; most accessible tissue: Minghui63 young leaf, score: 51.901 | N | N | N | N |
| vg1106425390 | G -> A | LOC_Os11g11550.2 | upstream_gene_variant ; 1040.0bp to feature; MODIFIER | silent_mutation | Average:27.673; most accessible tissue: Minghui63 young leaf, score: 51.901 | N | N | N | N |
| vg1106425390 | G -> A | LOC_Os11g11550-LOC_Os11g11560 | intergenic_region ; MODIFIER | silent_mutation | Average:27.673; most accessible tissue: Minghui63 young leaf, score: 51.901 | N | N | N | N |
| vg1106425390 | G -> DEL | N | N | silent_mutation | Average:27.673; most accessible tissue: Minghui63 young leaf, score: 51.901 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1106425390 | NA | 9.34E-06 | mr1042 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1106425390 | NA | 1.39E-10 | mr1180 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1106425390 | NA | 5.98E-06 | mr1912 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1106425390 | 4.26E-06 | 4.26E-06 | mr1912_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |