\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1106187045:

Variant ID: vg1106187045 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 6187045
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTCTATCCATGTGCGGTAATCATCTCGAAGCACCTCAATTCAACCCGATGTCATACACCAAGTTGTATTGTCGGAATCGGCTGCATCAGCCCACCTAGTC[C/T]
GACTCAGACTCAGCCGATCCTAATCGTAGTCGATCTGGACTCTAGCCGATTCCTGCTTTGTTCCTGAATCGATCTCCGCCTTCAACTCCACTTCGATCTA

Reverse complement sequence

TAGATCGAAGTGGAGTTGAAGGCGGAGATCGATTCAGGAACAAAGCAGGAATCGGCTAGAGTCCAGATCGACTACGATTAGGATCGGCTGAGTCTGAGTC[G/A]
GACTAGGTGGGCTGATGCAGCCGATTCCGACAATACAACTTGGTGTATGACATCGGGTTGAATTGAGGTGCTTCGAGATGATTACCGCACATGGATAGAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 95.60% 4.40% 0.02% 0.00% NA
All Indica  2759 99.30% 0.70% 0.00% 0.00% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 32.30% 67.30% 0.37% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 99.70% 0.30% 0.00% 0.00% NA
Indica Intermediate  786 98.00% 2.00% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 94.80% 5.20% 0.00% 0.00% NA
Intermediate  90 97.80% 2.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1106187045 C -> T LOC_Os11g11170.1 upstream_gene_variant ; 3614.0bp to feature; MODIFIER silent_mutation Average:26.725; most accessible tissue: Zhenshan97 flag leaf, score: 38.066 N N N N
vg1106187045 C -> T LOC_Os11g11180.1 downstream_gene_variant ; 3145.0bp to feature; MODIFIER silent_mutation Average:26.725; most accessible tissue: Zhenshan97 flag leaf, score: 38.066 N N N N
vg1106187045 C -> T LOC_Os11g11170-LOC_Os11g11180 intergenic_region ; MODIFIER silent_mutation Average:26.725; most accessible tissue: Zhenshan97 flag leaf, score: 38.066 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1106187045 1.61E-07 NA mr1083 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1106187045 NA 5.99E-06 mr1230 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1106187045 NA 1.29E-06 mr1321 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1106187045 NA 3.65E-09 mr1348 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1106187045 NA 5.40E-06 mr1349 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1106187045 NA 3.97E-09 mr1465 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1106187045 NA 6.78E-07 mr1556 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1106187045 NA 2.12E-09 mr1669 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1106187045 NA 1.08E-10 mr1696 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1106187045 NA 1.16E-06 mr1735 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1106187045 NA 8.85E-06 mr1738 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1106187045 NA 7.87E-06 mr1729_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251