\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1105927934:

Variant ID: vg1105927934 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 5927934
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


TTTTTGAATTAACCAAACTGAAAAAGAAAAACAGGGAGAGTATGTCACGTAGCAATCAGCATACAATTATCCCATTTCACATAGCCAGCAAACAATTTGT[G/A]
AGCCCTATGGCATTGTGCTTTGGAGAATTTGTCGCTAACTAATTGCTTGAAGTTATGTATCTTTCTTTCCTAAGATGAATGCATATTTCGAGCAATAAAT

Reverse complement sequence

ATTTATTGCTCGAAATATGCATTCATCTTAGGAAAGAAAGATACATAACTTCAAGCAATTAGTTAGCGACAAATTCTCCAAAGCACAATGCCATAGGGCT[C/T]
ACAAATTGTTTGCTGGCTATGTGAAATGGGATAATTGTATGCTGATTGCTACGTGACATACTCTCCCTGTTTTTCTTTTTCAGTTTGGTTAATTCAAAAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.90% 40.00% 0.02% 0.00% NA
All Indica  2759 80.80% 19.10% 0.04% 0.00% NA
All Japonica  1512 19.90% 80.10% 0.00% 0.00% NA
Aus  269 92.90% 7.10% 0.00% 0.00% NA
Indica I  595 95.50% 4.40% 0.17% 0.00% NA
Indica II  465 90.10% 9.90% 0.00% 0.00% NA
Indica III  913 71.00% 29.00% 0.00% 0.00% NA
Indica Intermediate  786 75.70% 24.30% 0.00% 0.00% NA
Temperate Japonica  767 32.50% 67.50% 0.00% 0.00% NA
Tropical Japonica  504 4.00% 96.00% 0.00% 0.00% NA
Japonica Intermediate  241 13.30% 86.70% 0.00% 0.00% NA
VI/Aromatic  96 11.50% 88.50% 0.00% 0.00% NA
Intermediate  90 45.60% 54.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1105927934 G -> A LOC_Os11g10780.1 upstream_gene_variant ; 4156.0bp to feature; MODIFIER silent_mutation Average:78.501; most accessible tissue: Minghui63 flower, score: 88.359 N N N N
vg1105927934 G -> A LOC_Os11g10780-LOC_Os11g10790 intergenic_region ; MODIFIER silent_mutation Average:78.501; most accessible tissue: Minghui63 flower, score: 88.359 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1105927934 G A -0.03 -0.03 -0.03 -0.04 -0.06 -0.07

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1105927934 NA 2.32E-06 mr1216 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105927934 NA 2.38E-13 mr1521 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105927934 NA 9.79E-06 mr1740 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105927934 NA 7.86E-06 mr1832 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105927934 NA 1.27E-07 mr1835 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105927934 NA 1.93E-10 mr1904 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105927934 1.75E-06 NA mr1158_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105927934 NA 1.05E-07 mr1645_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105927934 NA 1.71E-06 mr1648_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251