\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1105921472:

Variant ID: vg1105921472 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 5921472
Reference Allele: AAlternative Allele: G,T
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAAAATCATATTAATCCATTTTTAAAGTTTAAAATAATTAATACTCAATTAATCATGTGCTAATGGCTCACCTCGTTTTGCGTATCTTCCCCATCTCCCT[A/G,T]
ATCCCCATCTCCTCAAACACACCCTAATTCGCTCAGTATCTTGAGTGCCTTTCCCTCCCAAGTATCATGATGAGCGTTTCATGCAATTTTGTTTTCAAAA

Reverse complement sequence

TTTTGAAAACAAAATTGCATGAAACGCTCATCATGATACTTGGGAGGGAAAGGCACTCAAGATACTGAGCGAATTAGGGTGTGTTTGAGGAGATGGGGAT[T/C,A]
AGGGAGATGGGGAAGATACGCAAAACGAGGTGAGCCATTAGCACATGATTAATTGAGTATTAATTATTTTAAACTTTAAAAATGGATTAATATGATTTTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 88.20% 11.20% 0.13% 0.00% T: 0.49%
All Indica  2759 81.20% 17.80% 0.22% 0.00% T: 0.76%
All Japonica  1512 99.50% 0.40% 0.00% 0.00% T: 0.07%
Aus  269 92.90% 7.10% 0.00% 0.00% NA
Indica I  595 68.60% 29.60% 0.84% 0.00% T: 1.01%
Indica II  465 98.30% 1.30% 0.00% 0.00% T: 0.43%
Indica III  913 78.10% 21.80% 0.11% 0.00% NA
Indica Intermediate  786 84.20% 14.10% 0.00% 0.00% T: 1.65%
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 98.60% 1.20% 0.00% 0.00% T: 0.20%
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 87.80% 11.10% 0.00% 0.00% T: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1105921472 A -> T LOC_Os11g10770.1 upstream_gene_variant ; 2443.0bp to feature; MODIFIER silent_mutation Average:68.1; most accessible tissue: Zhenshan97 panicle, score: 78.302 N N N N
vg1105921472 A -> T LOC_Os11g10780.1 downstream_gene_variant ; 133.0bp to feature; MODIFIER silent_mutation Average:68.1; most accessible tissue: Zhenshan97 panicle, score: 78.302 N N N N
vg1105921472 A -> T LOC_Os11g10770-LOC_Os11g10780 intergenic_region ; MODIFIER silent_mutation Average:68.1; most accessible tissue: Zhenshan97 panicle, score: 78.302 N N N N
vg1105921472 A -> G LOC_Os11g10770.1 upstream_gene_variant ; 2443.0bp to feature; MODIFIER silent_mutation Average:68.1; most accessible tissue: Zhenshan97 panicle, score: 78.302 N N N N
vg1105921472 A -> G LOC_Os11g10780.1 downstream_gene_variant ; 133.0bp to feature; MODIFIER silent_mutation Average:68.1; most accessible tissue: Zhenshan97 panicle, score: 78.302 N N N N
vg1105921472 A -> G LOC_Os11g10770-LOC_Os11g10780 intergenic_region ; MODIFIER silent_mutation Average:68.1; most accessible tissue: Zhenshan97 panicle, score: 78.302 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1105921472 NA 2.65E-15 Plant_height Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1105921472 3.24E-06 3.92E-11 mr1042 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105921472 7.24E-06 1.19E-12 mr1042 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105921472 5.33E-06 1.15E-10 mr1043 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105921472 5.87E-06 2.18E-12 mr1043 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105921472 NA 2.67E-09 mr1143 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105921472 NA 8.40E-09 mr1167 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105921472 NA 7.52E-09 mr1185 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105921472 NA 5.33E-09 mr1185 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105921472 NA 1.86E-08 mr1269 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105921472 8.99E-06 2.56E-08 mr1269 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105921472 NA 2.12E-09 mr1399 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105921472 NA 5.44E-08 mr1399 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105921472 NA 6.62E-08 mr1479 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105921472 NA 3.04E-08 mr1479 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105921472 NA 1.74E-06 mr1502 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105921472 NA 6.23E-10 mr1535 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105921472 NA 1.27E-09 mr1675 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105921472 NA 6.58E-06 mr1698 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105921472 NA 3.06E-06 mr1742 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105921472 NA 3.61E-09 mr1912 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105921472 7.80E-06 1.73E-10 mr1912 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105921472 NA 8.39E-07 mr1919 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105921472 NA 2.45E-08 mr1919 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105921472 NA 2.34E-06 mr1950 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105921472 NA 4.43E-09 mr1969 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105921472 NA 5.88E-09 mr1975 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105921472 NA 2.42E-08 mr1975 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105921472 NA 4.71E-08 mr1330_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105921472 NA 9.81E-10 mr1378_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105921472 NA 1.88E-09 mr1378_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105921472 NA 1.49E-08 mr1517_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105921472 NA 1.07E-06 mr1653_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251