\
| Variant ID: vg1105905203 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 5905203 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, A: 0.03, others allele: 0.00, population size: 195. )
ATATAAGTGATTTTGGAGATATGTGATACTTCCTAAGACTACGAATCTGAACAGGAAAAGTATCGCATCCCTCCAAAATCCCTTATATTATGGGACTGAT[G/A]
GAGTAAATGATATGTGTGCATGTTACATTTTGTTTGGTGCATAGATTAAACACCACCACACCATCTTACTATAATACGTTACATATGAAAATTTACAAAA
TTTTGTAAATTTTCATATGTAACGTATTATAGTAAGATGGTGTGGTGGTGTTTAATCTATGCACCAAACAAAATGTAACATGCACACATATCATTTACTC[C/T]
ATCAGTCCCATAATATAAGGGATTTTGGAGGGATGCGATACTTTTCCTGTTCAGATTCGTAGTCTTAGGAAGTATCACATATCTCCAAAATCACTTATAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 83.60% | 16.30% | 0.11% | 0.00% | NA |
| All Indica | 2759 | 77.70% | 22.10% | 0.18% | 0.00% | NA |
| All Japonica | 1512 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Aus | 269 | 50.60% | 49.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 67.40% | 32.10% | 0.50% | 0.00% | NA |
| Indica II | 465 | 95.90% | 3.90% | 0.22% | 0.00% | NA |
| Indica III | 913 | 73.30% | 26.70% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 79.80% | 20.10% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 98.60% | 1.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 94.80% | 5.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 83.30% | 16.70% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1105905203 | G -> A | LOC_Os11g10750.1 | upstream_gene_variant ; 2510.0bp to feature; MODIFIER | silent_mutation | Average:58.226; most accessible tissue: Zhenshan97 flag leaf, score: 83.684 | N | N | N | N |
| vg1105905203 | G -> A | LOC_Os11g10760.1 | downstream_gene_variant ; 2747.0bp to feature; MODIFIER | silent_mutation | Average:58.226; most accessible tissue: Zhenshan97 flag leaf, score: 83.684 | N | N | N | N |
| vg1105905203 | G -> A | LOC_Os11g10750-LOC_Os11g10760 | intergenic_region ; MODIFIER | silent_mutation | Average:58.226; most accessible tissue: Zhenshan97 flag leaf, score: 83.684 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1105905203 | NA | 1.45E-08 | mr1042 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105905203 | NA | 1.03E-10 | mr1042 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105905203 | NA | 4.82E-08 | mr1043 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105905203 | NA | 4.34E-10 | mr1043 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105905203 | NA | 4.91E-08 | mr1185 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105905203 | NA | 2.83E-08 | mr1185 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105905203 | NA | 1.75E-07 | mr1269 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105905203 | NA | 9.80E-08 | mr1269 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105905203 | NA | 4.45E-10 | mr1399 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105905203 | NA | 2.60E-07 | mr1399 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105905203 | NA | 1.19E-07 | mr1479 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105905203 | NA | 1.26E-07 | mr1479 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105905203 | NA | 2.02E-06 | mr1502 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105905203 | NA | 2.05E-06 | mr1543 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105905203 | NA | 9.38E-07 | mr1662 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105905203 | NA | 1.96E-07 | mr1742 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105905203 | NA | 4.11E-06 | mr1912 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105905203 | NA | 1.59E-08 | mr1912 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105905203 | NA | 1.78E-08 | mr1919 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105905203 | NA | 1.85E-08 | mr1975 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105905203 | NA | 7.03E-08 | mr1975 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105905203 | NA | 1.21E-07 | mr1517_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105905203 | NA | 6.07E-06 | mr1864_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105905203 | NA | 7.16E-06 | mr1892_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |