\
| Variant ID: vg1105905120 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 5905120 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
ACCATGATAAAAGATATCTCAAGTTTTAAAATTTAAAATTTGGTTGCAGTTTATAATGTAAAGGGTACTCCCTCTGTCCCATAATATAAGTGATTTTGGA[G/A]
ATATGTGATACTTCCTAAGACTACGAATCTGAACAGGAAAAGTATCGCATCCCTCCAAAATCCCTTATATTATGGGACTGATGGAGTAAATGATATGTGT
ACACATATCATTTACTCCATCAGTCCCATAATATAAGGGATTTTGGAGGGATGCGATACTTTTCCTGTTCAGATTCGTAGTCTTAGGAAGTATCACATAT[C/T]
TCCAAAATCACTTATATTATGGGACAGAGGGAGTACCCTTTACATTATAAACTGCAACCAAATTTTAAATTTTAAAACTTGAGATATCTTTTATCATGGT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 87.30% | 12.50% | 0.15% | 0.00% | NA |
| All Indica | 2759 | 79.80% | 20.00% | 0.25% | 0.00% | NA |
| All Japonica | 1512 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Aus | 269 | 92.90% | 7.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 67.10% | 32.60% | 0.34% | 0.00% | NA |
| Indica II | 465 | 96.10% | 3.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 78.20% | 21.50% | 0.33% | 0.00% | NA |
| Indica Intermediate | 786 | 81.60% | 18.20% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 98.60% | 1.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 85.60% | 14.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1105905120 | G -> A | LOC_Os11g10750.1 | upstream_gene_variant ; 2427.0bp to feature; MODIFIER | silent_mutation | Average:47.864; most accessible tissue: Zhenshan97 flag leaf, score: 80.588 | N | N | N | N |
| vg1105905120 | G -> A | LOC_Os11g10760.1 | downstream_gene_variant ; 2830.0bp to feature; MODIFIER | silent_mutation | Average:47.864; most accessible tissue: Zhenshan97 flag leaf, score: 80.588 | N | N | N | N |
| vg1105905120 | G -> A | LOC_Os11g10750-LOC_Os11g10760 | intergenic_region ; MODIFIER | silent_mutation | Average:47.864; most accessible tissue: Zhenshan97 flag leaf, score: 80.588 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1105905120 | 2.30E-06 | 2.56E-10 | mr1042 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105905120 | 5.83E-06 | 1.21E-11 | mr1042 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105905120 | NA | 1.56E-09 | mr1043 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105905120 | NA | 5.52E-11 | mr1043 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105905120 | 4.87E-06 | 6.08E-09 | mr1185 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105905120 | 4.50E-06 | 5.74E-09 | mr1185 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105905120 | 7.18E-06 | 1.27E-08 | mr1269 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105905120 | 3.41E-06 | 2.36E-08 | mr1269 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105905120 | NA | 2.44E-09 | mr1399 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105905120 | NA | 1.64E-07 | mr1399 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105905120 | NA | 1.02E-07 | mr1479 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105905120 | NA | 6.07E-08 | mr1479 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105905120 | NA | 2.28E-06 | mr1502 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105905120 | NA | 1.67E-08 | mr1535 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105905120 | NA | 2.51E-06 | mr1543 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105905120 | NA | 4.77E-08 | mr1742 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105905120 | NA | 3.84E-08 | mr1912 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105905120 | 9.91E-06 | 2.50E-09 | mr1912 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105905120 | NA | 3.91E-06 | mr1919 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105905120 | NA | 1.84E-07 | mr1919 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105905120 | NA | 6.66E-09 | mr1975 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105905120 | NA | 3.63E-08 | mr1975 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105905120 | NA | 2.27E-08 | mr1517_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105905120 | NA | 7.55E-07 | mr1653_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105905120 | NA | 7.99E-06 | mr1864_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105905120 | NA | 6.11E-06 | mr1892_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |