\
| Variant ID: vg1105900588 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 5900588 |
| Reference Allele: T | Alternative Allele: G |
| Primary Allele: T | Secondary Allele: G |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.94, G: 0.06, others allele: 0.00, population size: 281. )
GAACCCATTTGATTTCTCATTATGTGTGAGAAGTACATCGGTGAGTTGCGGTATATAATGCCCTGAATTATTCGCCAATCAGTCAAAGTGCACGACAGAA[T/G]
TTAAACATTTAAATGTGAAATAAGACTCAGGAATACTCTCTGACCTGCATAGCTCTCTCCACTAAGAAGTAGCCCTCTTGACCTGTATTCAGGGAACTTC
GAAGTTCCCTGAATACAGGTCAAGAGGGCTACTTCTTAGTGGAGAGAGCTATGCAGGTCAGAGAGTATTCCTGAGTCTTATTTCACATTTAAATGTTTAA[A/C]
TTCTGTCGTGCACTTTGACTGATTGGCGAATAATTCAGGGCATTATATACCGCAACTCACCGATGTACTTCTCACACATAATGAGAAATCAAATGGGTTC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 86.40% | 13.50% | 0.08% | 0.00% | NA |
| All Indica | 2759 | 82.30% | 17.70% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 99.50% | 0.50% | 0.07% | 0.00% | NA |
| Aus | 269 | 51.70% | 48.00% | 0.37% | 0.00% | NA |
| Indica I | 595 | 77.00% | 22.90% | 0.17% | 0.00% | NA |
| Indica II | 465 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 73.30% | 26.70% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 87.70% | 12.30% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.40% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 93.80% | 6.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 88.90% | 10.00% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1105900588 | T -> G | LOC_Os11g10740.1 | downstream_gene_variant ; 3812.0bp to feature; MODIFIER | silent_mutation | Average:63.08; most accessible tissue: Minghui63 flag leaf, score: 75.341 | N | N | N | N |
| vg1105900588 | T -> G | LOC_Os11g10750.1 | intron_variant ; MODIFIER | silent_mutation | Average:63.08; most accessible tissue: Minghui63 flag leaf, score: 75.341 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1105900588 | NA | 2.37E-06 | mr1042 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105900588 | NA | 5.70E-09 | mr1042 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105900588 | NA | 1.77E-06 | mr1043 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105900588 | 2.49E-06 | 2.03E-09 | mr1043 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105900588 | NA | 3.53E-06 | mr1282 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105900588 | NA | 1.16E-07 | mr1912 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105900588 | 8.95E-07 | 4.42E-08 | mr1043_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105900588 | NA | 6.50E-07 | mr1330_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105900588 | NA | 2.16E-07 | mr1378_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105900588 | NA | 2.42E-06 | mr1743_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |