Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1105884811:

Variant ID: vg1105884811 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 5884811
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GTGAGCTTGTGCGCATGTTTAGTACCACATTGCTAGTTTAGCAAGTGTGGAACCGACTTATAAGGCCTTGTCTCTCCAACCATGCCACTCTCGGGTTAAC[T/C]
ATTTTACACGAAGCGAGGACGAAAATGTAAGTGGAGTGGTATGTGTAAGTGGACCCGTCCGTCGAATGGGCTGGCTACATGGTTCTGGAGGGAGGGCTGT

Reverse complement sequence

ACAGCCCTCCCTCCAGAACCATGTAGCCAGCCCATTCGACGGACGGGTCCACTTACACATACCACTCCACTTACATTTTCGTCCTCGCTTCGTGTAAAAT[A/G]
GTTAACCCGAGAGTGGCATGGTTGGAGAGACAAGGCCTTATAAGTCGGTTCCACACTTGCTAAACTAGCAATGTGGTACTAAACATGCGCACAAGCTCAC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	65.30%	34.20%	0.42%	0.00%	NA
All Indica	2759	96.00%	3.80%	0.11%	0.00%	NA
All Japonica	1512	14.90%	84.50%	0.60%	0.00%	NA
Aus	269	55.00%	45.00%	0.00%	0.00%	NA
Indica I	595	99.00%	0.80%	0.17%	0.00%	NA
Indica II	465	97.80%	2.20%	0.00%	0.00%	NA
Indica III	913	94.50%	5.50%	0.00%	0.00%	NA
Indica Intermediate	786	94.50%	5.20%	0.25%	0.00%	NA
Temperate Japonica	767	4.60%	95.40%	0.00%	0.00%	NA
Tropical Japonica	504	30.40%	68.50%	1.19%	0.00%	NA
Japonica Intermediate	241	15.40%	83.40%	1.24%	0.00%	NA
VI/Aromatic	96	6.20%	87.50%	6.25%	0.00%	NA
Intermediate	90	65.60%	32.20%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1105884811	T -> C	LOC_Os11g10710.1	upstream_gene_variant ; 4098.0bp to feature; MODIFIER	silent_mutation	Average:84.251; most accessible tissue: Minghui63 young leaf, score: 87.526	N	N	N	N
vg1105884811	T -> C	LOC_Os11g10720.1	upstream_gene_variant ; 4730.0bp to feature; MODIFIER	silent_mutation	Average:84.251; most accessible tissue: Minghui63 young leaf, score: 87.526	N	N	N	N
vg1105884811	T -> C	LOC_Os11g10710-LOC_Os11g10720	intergenic_region ; MODIFIER	silent_mutation	Average:84.251; most accessible tissue: Minghui63 young leaf, score: 87.526	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg1105884811	T	C	-0.03	-0.01	0.0	0.0	0.0	0.01

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1105884811	NA	3.58E-17	Awn_length	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1105884811	NA	4.18E-06	mr1020_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105884811	NA	1.27E-08	mr1198_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105884811	NA	4.57E-13	mr1217_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105884811	NA	2.81E-07	mr1275_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105884811	NA	2.80E-22	mr1401_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105884811	NA	8.50E-07	mr1418_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105884811	NA	7.09E-10	mr1506_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105884811	NA	5.20E-15	mr1575_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105884811	NA	5.14E-07	mr1604_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105884811	NA	1.02E-08	mr1660_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105884811	6.29E-06	NA	mr1662_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105884811	1.36E-06	NA	mr1705_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105884811	NA	8.85E-07	mr1824_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105884811	NA	5.47E-06	mr1869_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105884811	6.11E-06	NA	mr1870_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105884811	NA	5.17E-22	mr1924_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251