\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1105884811:

Variant ID: vg1105884811 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 5884811
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTGAGCTTGTGCGCATGTTTAGTACCACATTGCTAGTTTAGCAAGTGTGGAACCGACTTATAAGGCCTTGTCTCTCCAACCATGCCACTCTCGGGTTAAC[T/C]
ATTTTACACGAAGCGAGGACGAAAATGTAAGTGGAGTGGTATGTGTAAGTGGACCCGTCCGTCGAATGGGCTGGCTACATGGTTCTGGAGGGAGGGCTGT

Reverse complement sequence

ACAGCCCTCCCTCCAGAACCATGTAGCCAGCCCATTCGACGGACGGGTCCACTTACACATACCACTCCACTTACATTTTCGTCCTCGCTTCGTGTAAAAT[A/G]
GTTAACCCGAGAGTGGCATGGTTGGAGAGACAAGGCCTTATAAGTCGGTTCCACACTTGCTAAACTAGCAATGTGGTACTAAACATGCGCACAAGCTCAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.30% 34.20% 0.42% 0.00% NA
All Indica  2759 96.00% 3.80% 0.11% 0.00% NA
All Japonica  1512 14.90% 84.50% 0.60% 0.00% NA
Aus  269 55.00% 45.00% 0.00% 0.00% NA
Indica I  595 99.00% 0.80% 0.17% 0.00% NA
Indica II  465 97.80% 2.20% 0.00% 0.00% NA
Indica III  913 94.50% 5.50% 0.00% 0.00% NA
Indica Intermediate  786 94.50% 5.20% 0.25% 0.00% NA
Temperate Japonica  767 4.60% 95.40% 0.00% 0.00% NA
Tropical Japonica  504 30.40% 68.50% 1.19% 0.00% NA
Japonica Intermediate  241 15.40% 83.40% 1.24% 0.00% NA
VI/Aromatic  96 6.20% 87.50% 6.25% 0.00% NA
Intermediate  90 65.60% 32.20% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1105884811 T -> C LOC_Os11g10710.1 upstream_gene_variant ; 4098.0bp to feature; MODIFIER silent_mutation Average:84.251; most accessible tissue: Minghui63 young leaf, score: 87.526 N N N N
vg1105884811 T -> C LOC_Os11g10720.1 upstream_gene_variant ; 4730.0bp to feature; MODIFIER silent_mutation Average:84.251; most accessible tissue: Minghui63 young leaf, score: 87.526 N N N N
vg1105884811 T -> C LOC_Os11g10710-LOC_Os11g10720 intergenic_region ; MODIFIER silent_mutation Average:84.251; most accessible tissue: Minghui63 young leaf, score: 87.526 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1105884811 T C -0.03 -0.01 0.0 0.0 0.0 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1105884811 NA 3.58E-17 Awn_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1105884811 NA 4.18E-06 mr1020_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105884811 NA 1.27E-08 mr1198_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105884811 NA 4.57E-13 mr1217_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105884811 NA 2.81E-07 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105884811 NA 2.80E-22 mr1401_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105884811 NA 8.50E-07 mr1418_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105884811 NA 7.09E-10 mr1506_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105884811 NA 5.20E-15 mr1575_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105884811 NA 5.14E-07 mr1604_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105884811 NA 1.02E-08 mr1660_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105884811 6.29E-06 NA mr1662_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105884811 1.36E-06 NA mr1705_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105884811 NA 8.85E-07 mr1824_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105884811 NA 5.47E-06 mr1869_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105884811 6.11E-06 NA mr1870_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105884811 NA 5.17E-22 mr1924_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251