\
| Variant ID: vg1105862690 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 5862690 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
TATGGTTCCTTACTTATTAAAAGTTACCTCTATGTGAGTTGACATATTATATATCTTAAGTGAATGACTATATCCAAGGAAATATTGACCACATCTTATT[A/G]
AAGGAAATACTGTAGGGGTCTCAGATAATTTTTGGTTCACCTCAATCAGATTTAAAATGATTTTAATGTGAATTTTGAAAGTTTGGCCACTTTAAAAGAA
TTCTTTTAAAGTGGCCAAACTTTCAAAATTCACATTAAAATCATTTTAAATCTGATTGAGGTGAACCAAAAATTATCTGAGACCCCTACAGTATTTCCTT[T/C]
AATAAGATGTGGTCAATATTTCCTTGGATATAGTCATTCACTTAAGATATATAATATGTCAACTCACATAGAGGTAACTTTTAATAAGTAAGGAACCATA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 90.40% | 9.60% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 92.60% | 7.30% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 16.70% | 83.30% | 0.00% | 0.00% | NA |
| Indica I | 595 | 97.50% | 2.50% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
| Indica III | 913 | 86.50% | 13.50% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 92.50% | 7.40% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 97.00% | 3.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 92.70% | 6.20% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 94.40% | 5.60% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1105862690 | A -> G | LOC_Os11g10670-LOC_Os11g10710 | intergenic_region ; MODIFIER | silent_mutation | Average:24.488; most accessible tissue: Callus, score: 57.761 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1105862690 | NA | 9.49E-07 | mr1126 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105862690 | NA | 1.53E-06 | mr1420 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105862690 | NA | 3.67E-06 | mr1445 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105862690 | NA | 7.75E-06 | mr1545 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105862690 | NA | 1.36E-06 | mr1556 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105862690 | 4.04E-06 | NA | mr1970 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |