\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1105849420:

Variant ID: vg1105849420 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 5849420
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.76, G: 0.24, others allele: 0.00, population size: 41. )

Flanking Sequence (100 bp) in Reference Genome:


CCTACGTATGGCCGTGCGAGCTGGTGTCAGCGGTGGAGGTGGTTGGCAGGTGTCAACGACAGCATCTCTTCGGGCGGCGGAGGACGACGGCAGCCTAAGC[A/G]
TCGCCGGCGTATCCTTAGCAGGGAAACGGCAGGTTTGGGTAGAGGTGGACTCGTTCGCAGCGGCGTGGGAGTCCGGGTGGAAGACTTCTCCGGCGGCGAC

Reverse complement sequence

GTCGCCGCCGGAGAAGTCTTCCACCCGGACTCCCACGCCGCTGCGAACGAGTCCACCTCTACCCAAACCTGCCGTTTCCCTGCTAAGGATACGCCGGCGA[T/C]
GCTTAGGCTGCCGTCGTCCTCCGCCGCCCGAAGAGATGCTGTCGTTGACACCTGCCAACCACCTCCACCGCTGACACCAGCTCGCACGGCCATACGTAGG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 29.90% 25.00% 0.76% 44.31% NA
All Indica  2759 2.60% 25.50% 1.16% 70.75% NA
All Japonica  1512 83.20% 11.40% 0.07% 5.36% NA
Aus  269 3.30% 87.00% 0.74% 8.92% NA
Indica I  595 3.00% 11.60% 1.01% 84.37% NA
Indica II  465 3.00% 9.50% 1.94% 85.59% NA
Indica III  913 1.30% 36.10% 0.77% 61.77% NA
Indica Intermediate  786 3.60% 33.10% 1.27% 62.09% NA
Temperate Japonica  767 91.30% 1.70% 0.13% 6.91% NA
Tropical Japonica  504 72.00% 26.40% 0.00% 1.59% NA
Japonica Intermediate  241 80.90% 10.80% 0.00% 8.30% NA
VI/Aromatic  96 51.00% 45.80% 0.00% 3.12% NA
Intermediate  90 30.00% 31.10% 1.11% 37.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1105849420 A -> DEL N N silent_mutation Average:17.648; most accessible tissue: Minghui63 panicle, score: 68.46 N N N N
vg1105849420 A -> G LOC_Os11g10670.1 downstream_gene_variant ; 2633.0bp to feature; MODIFIER silent_mutation Average:17.648; most accessible tissue: Minghui63 panicle, score: 68.46 N N N N
vg1105849420 A -> G LOC_Os11g10650-LOC_Os11g10670 intergenic_region ; MODIFIER silent_mutation Average:17.648; most accessible tissue: Minghui63 panicle, score: 68.46 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1105849420 NA 1.08E-06 mr1028 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105849420 NA 1.31E-08 mr1245 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105849420 NA 8.66E-08 mr1315 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105849420 NA 1.00E-06 mr1369 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105849420 NA 5.28E-07 mr1373 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105849420 NA 2.34E-06 mr1418 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105849420 4.47E-06 4.47E-06 mr1419 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105849420 NA 1.13E-08 mr1420 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105849420 NA 1.38E-09 mr1439 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105849420 NA 6.83E-07 mr1445 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105849420 NA 6.37E-10 mr1488 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105849420 NA 2.47E-07 mr1556 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105849420 NA 2.33E-07 mr1604 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105849420 NA 4.06E-07 mr1662 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105849420 NA 8.33E-09 mr1764 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105849420 NA 1.62E-07 mr1797 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105849420 NA 1.62E-07 mr1801 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105849420 NA 3.81E-06 mr1832 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105849420 NA 8.50E-14 mr1909 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105849420 NA 1.67E-10 mr1921 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251