\
| Variant ID: vg1105804727 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 5804727 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 107. )
TGTGATCTGCTTGAATGGAACGTACTATAGGTATCTCCCGGGTTCCAACAAGCTTGTGTACATGCAGCACCGGCGGTTCCTACGCACAAATCACAAGTAC[C/T]
GCAAGATGAAGGCGGAGTTCGATGGTACTGAAGAGACTAATCCTGCACCGAAACCTACATCGGGAGAAAAGGTGTGTGCAATGACAGAGAAAATTGTTTG
CAAACAATTTTCTCTGTCATTGCACACACCTTTTCTCCCGATGTAGGTTTCGGTGCAGGATTAGTCTCTTCAGTACCATCGAACTCCGCCTTCATCTTGC[G/A]
GTACTTGTGATTTGTGCGTAGGAACCGCCGGTGCTGCATGTACACAAGCTTGTTGGAACCCGGGAGATACCTATAGTACGTTCCATTCAAGCAGATCACA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 87.10% | 4.30% | 8.55% | 0.04% | NA |
| All Indica | 2759 | 79.30% | 6.80% | 13.88% | 0.07% | NA |
| All Japonica | 1512 | 98.80% | 0.60% | 0.60% | 0.00% | NA |
| Aus | 269 | 99.30% | 0.00% | 0.74% | 0.00% | NA |
| Indica I | 595 | 98.50% | 0.20% | 1.18% | 0.17% | NA |
| Indica II | 465 | 44.70% | 14.60% | 40.65% | 0.00% | NA |
| Indica III | 913 | 84.10% | 8.00% | 7.78% | 0.11% | NA |
| Indica Intermediate | 786 | 79.50% | 5.70% | 14.76% | 0.00% | NA |
| Temperate Japonica | 767 | 98.30% | 0.80% | 0.91% | 0.00% | NA |
| Tropical Japonica | 504 | 99.40% | 0.20% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 81.10% | 7.80% | 11.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1105804727 | C -> T | LOC_Os11g10580.1 | missense_variant ; p.Arg385Cys; MODERATE | nonsynonymous_codon ; R385C | Average:12.782; most accessible tissue: Minghui63 root, score: 25.504 | benign |
0.716 |
DELETERIOUS | 0.02 |
| vg1105804727 | C -> DEL | LOC_Os11g10580.1 | N | frameshift_variant | Average:12.782; most accessible tissue: Minghui63 root, score: 25.504 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1105804727 | NA | 6.08E-09 | mr1354 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105804727 | NA | 3.73E-09 | mr1354 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105804727 | NA | 7.48E-07 | mr1543 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105804727 | NA | 7.33E-06 | mr1360_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105804727 | NA | 6.14E-06 | mr1497_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105804727 | NA | 4.41E-06 | mr1497_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105804727 | NA | 9.27E-06 | mr1712_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105804727 | NA | 7.57E-06 | mr1717_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105804727 | NA | 2.18E-06 | mr1732_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105804727 | NA | 5.51E-06 | mr1895_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105804727 | NA | 4.53E-07 | mr1910_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |