\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1105769627:

Variant ID: vg1105769627 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 5769627
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.58, G: 0.42, others allele: 0.00, population size: 104. )

Flanking Sequence (100 bp) in Reference Genome:


TGCCTACATGGCGGTGTTGACCTGGTATTTGTCCCATGTCAATGGGTCCCACAAATATTTTTGGGTGAATGATAAATGGGTCATATATATATAATGCCAC[G/A]
TGGAACAAAGACTAGGTCAACACCGCTATGTAGGTGCCACGTCAGCGAAACCGTCCTTCAAAACTGTCGAGGAAGTCAAATTGCACTGATTTTAATAGTT

Reverse complement sequence

AACTATTAAAATCAGTGCAATTTGACTTCCTCGACAGTTTTGAAGGACGGTTTCGCTGACGTGGCACCTACATAGCGGTGTTGACCTAGTCTTTGTTCCA[C/T]
GTGGCATTATATATATATGACCCATTTATCATTCACCCAAAAATATTTGTGGGACCCATTGACATGGGACAAATACCAGGTCAACACCGCCATGTAGGCA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.80% 37.10% 0.13% 0.00% NA
All Indica  2759 88.50% 11.50% 0.07% 0.00% NA
All Japonica  1512 12.10% 87.90% 0.00% 0.00% NA
Aus  269 91.10% 8.20% 0.74% 0.00% NA
Indica I  595 85.50% 14.50% 0.00% 0.00% NA
Indica II  465 95.70% 4.10% 0.22% 0.00% NA
Indica III  913 87.10% 12.80% 0.11% 0.00% NA
Indica Intermediate  786 88.00% 12.00% 0.00% 0.00% NA
Temperate Japonica  767 7.80% 92.20% 0.00% 0.00% NA
Tropical Japonica  504 18.30% 81.70% 0.00% 0.00% NA
Japonica Intermediate  241 12.90% 87.10% 0.00% 0.00% NA
VI/Aromatic  96 46.90% 53.10% 0.00% 0.00% NA
Intermediate  90 58.90% 38.90% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1105769627 G -> A LOC_Os11g10540.1 upstream_gene_variant ; 4163.0bp to feature; MODIFIER silent_mutation Average:68.171; most accessible tissue: Zhenshan97 young leaf, score: 77.422 N N N N
vg1105769627 G -> A LOC_Os11g10530.1 downstream_gene_variant ; 1022.0bp to feature; MODIFIER silent_mutation Average:68.171; most accessible tissue: Zhenshan97 young leaf, score: 77.422 N N N N
vg1105769627 G -> A LOC_Os11g10530.2 downstream_gene_variant ; 1021.0bp to feature; MODIFIER silent_mutation Average:68.171; most accessible tissue: Zhenshan97 young leaf, score: 77.422 N N N N
vg1105769627 G -> A LOC_Os11g10520-LOC_Os11g10530 intergenic_region ; MODIFIER silent_mutation Average:68.171; most accessible tissue: Zhenshan97 young leaf, score: 77.422 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1105769627 NA 2.17E-06 mr1105_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105769627 NA 2.52E-10 mr1232_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105769627 NA 7.20E-07 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105769627 1.10E-06 1.10E-06 mr1281_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105769627 NA 7.89E-06 mr1289_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105769627 NA 1.33E-09 mr1506_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105769627 NA 5.19E-18 mr1557_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105769627 NA 4.95E-07 mr1604_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105769627 NA 4.48E-12 mr1636_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105769627 NA 4.86E-12 mr1641_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105769627 NA 5.40E-09 mr1659_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105769627 7.69E-06 1.01E-06 mr1659_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105769627 NA 6.84E-08 mr1681_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105769627 NA 1.99E-07 mr1683_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105769627 NA 3.99E-12 mr1714_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105769627 NA 6.44E-06 mr1752_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105769627 NA 5.15E-16 mr1767_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105769627 NA 3.01E-07 mr1824_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105769627 NA 5.43E-14 mr1838_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105769627 NA 6.50E-08 mr1909_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105769627 NA 4.31E-08 mr1921_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105769627 NA 1.07E-10 mr1986_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251