Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1105649773:

Variant ID: vg1105649773 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 5649773
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:


ACAAGGCCTGTGAGCTGCCATCGACCCGGGGTATGCCAAGTTCAGGAAGGACCGGCAAACAATGGCGGCCCTTCTCCAAGCCGTTCCCAAGGAAATGTTG[T/C]
GCCCCCTATCAAAGAAGGACAATGCCAAGGAAGTATGGGACGCGATCAAGACGATGAGCGTCGGTGTGGATCATGTTTGAGAAGTGCGCGAGCAGGCATT

Reverse complement sequence

AATGCCTGCTCGCGCACTTCTCAAACATGATCCACACCGACGCTCATCGTCTTGATCGCGTCCCATACTTCCTTGGCATTGTCCTTCTTTGATAGGGGGC[A/G]
CAACATTTCCTTGGGAACGGCTTGGAGAAGGGCCGCCATTGTTTGCCGGTCCTTCCTGAACTTGGCATACCCCGGGTCGATGGCAGCTCACAGGCCTTGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 70.70% 29.30% 0.04% 0.00% NA
All Indica  2759 99.00% 0.90% 0.04% 0.00% NA
All Japonica  1512 15.00% 85.00% 0.00% 0.00% NA
Aus  269 98.50% 1.50% 0.00% 0.00% NA
Indica I  595 99.70% 0.30% 0.00% 0.00% NA
Indica II  465 99.40% 0.60% 0.00% 0.00% NA
Indica III  913 99.50% 0.50% 0.00% 0.00% NA
Indica Intermediate  786 97.80% 2.00% 0.13% 0.00% NA
Temperate Japonica  767 11.30% 88.70% 0.00% 0.00% NA
Tropical Japonica  504 21.20% 78.80% 0.00% 0.00% NA
Japonica Intermediate  241 13.70% 86.30% 0.00% 0.00% NA
VI/Aromatic  96 51.00% 49.00% 0.00% 0.00% NA
Intermediate  90 73.30% 25.60% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1105649773 T -> C LOC_Os11g10410.1 missense_variant ; p.Cys14Arg; MODERATE nonsynonymous_codon ; C14H Average:70.623; most accessible tissue: Zhenshan97 young leaf, score: 83.623 unknown unknown DELETERIOUS 0.00
vg1105649773 T -> C LOC_Os11g10410.1 missense_variant ; p.Cys14Arg; MODERATE nonsynonymous_codon ; C14R Average:70.623; most accessible tissue: Zhenshan97 young leaf, score: 83.623 unknown unknown DELETERIOUS 0.00

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1105649773 NA 8.51E-27 mr1309 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105649773 NA 4.79E-08 mr1439 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105649773 NA 7.47E-13 mr1924 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105649773 NA 6.98E-20 mr1042_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105649773 NA 3.54E-09 mr1232_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105649773 NA 8.02E-07 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105649773 NA 7.69E-07 mr1453_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105649773 NA 9.00E-07 mr1479_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105649773 NA 4.85E-10 mr1506_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105649773 NA 3.47E-12 mr1636_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105649773 NA 6.24E-13 mr1641_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105649773 NA 4.58E-10 mr1646_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105649773 NA 1.97E-06 mr1662_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105649773 2.14E-07 2.14E-11 mr1680_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105649773 NA 1.66E-07 mr1683_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105649773 NA 8.37E-11 mr1714_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105649773 NA 2.09E-16 mr1767_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105649773 NA 2.72E-14 mr1838_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105649773 NA 2.12E-08 mr1909_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105649773 NA 2.84E-08 mr1921_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105649773 NA 6.48E-21 mr1924_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105649773 NA 1.41E-10 mr1986_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251