\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1105609281:

Variant ID: vg1105609281 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 5609281
Reference Allele: AAlternative Allele: C
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 54. )

Flanking Sequence (100 bp) in Reference Genome:


GCGACCTTGCTCCACGCAAGCACAAATCCTCGCTGGCGCGGTGTAGCACCGGGTCCACGTCATTGCACCGTGAGAGGCCTTACTTATGTCTGCTATACTT[A/C]
AGGAATGCGTCAGCTTATGTTGCAGGGTAACGGCTAGCACGGTGATTCCCTCTGTAGTTTGAAATGCTAGCTCCGCTCCCACCGCCTCCCGTCGGCGTCG

Reverse complement sequence

CGACGCCGACGGGAGGCGGTGGGAGCGGAGCTAGCATTTCAAACTACAGAGGGAATCACCGTGCTAGCCGTTACCCTGCAACATAAGCTGACGCATTCCT[T/G]
AAGTATAGCAGACATAAGTAAGGCCTCTCACGGTGCAATGACGTGGACCCGGTGCTACACCGCGCCAGCGAGGATTTGTGCTTGCGTGGAGCAAGGTCGC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.30% 14.80% 13.03% 10.85% NA
All Indica  2759 51.00% 23.30% 18.34% 7.36% NA
All Japonica  1512 82.90% 1.90% 1.79% 13.43% NA
Aus  269 62.50% 6.70% 24.16% 6.69% NA
Indica I  595 19.50% 46.90% 20.84% 12.77% NA
Indica II  465 60.60% 12.50% 23.44% 3.44% NA
Indica III  913 64.80% 18.60% 9.20% 7.34% NA
Indica Intermediate  786 53.20% 17.20% 24.05% 5.60% NA
Temperate Japonica  767 89.80% 0.30% 0.91% 9.00% NA
Tropical Japonica  504 82.10% 4.00% 2.18% 11.71% NA
Japonica Intermediate  241 62.70% 2.50% 3.73% 31.12% NA
VI/Aromatic  96 13.50% 0.00% 5.21% 81.25% NA
Intermediate  90 58.90% 14.40% 14.44% 12.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1105609281 A -> DEL N N silent_mutation Average:59.149; most accessible tissue: Zhenshan97 flag leaf, score: 92.201 N N N N
vg1105609281 A -> C LOC_Os11g10320.1 downstream_gene_variant ; 2012.0bp to feature; MODIFIER silent_mutation Average:59.149; most accessible tissue: Zhenshan97 flag leaf, score: 92.201 N N N N
vg1105609281 A -> C LOC_Os11g10330.1 downstream_gene_variant ; 1963.0bp to feature; MODIFIER silent_mutation Average:59.149; most accessible tissue: Zhenshan97 flag leaf, score: 92.201 N N N N
vg1105609281 A -> C LOC_Os11g10320-LOC_Os11g10330 intergenic_region ; MODIFIER silent_mutation Average:59.149; most accessible tissue: Zhenshan97 flag leaf, score: 92.201 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1105609281 A C -0.01 -0.02 0.01 0.0 0.03 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1105609281 NA 4.78E-66 mr1027 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105609281 NA 9.44E-22 mr1122 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105609281 NA 1.63E-45 mr1194 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105609281 NA 4.44E-15 mr1228 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105609281 NA 1.35E-08 mr1302 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105609281 NA 1.70E-06 mr1315 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105609281 NA 2.36E-06 mr1392 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105609281 NA 1.23E-07 mr1439 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105609281 NA 2.10E-08 mr1488 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105609281 NA 2.52E-15 mr1653 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105609281 NA 1.44E-07 mr1779 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105609281 NA 5.57E-07 mr1824 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105609281 NA 5.79E-06 mr1832 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105609281 NA 1.86E-21 mr1839 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105609281 NA 4.57E-15 mr1162_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105609281 NA 5.70E-07 mr1321_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105609281 NA 1.41E-34 mr1448_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105609281 NA 8.05E-45 mr1519_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105609281 NA 3.73E-14 mr1575_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105609281 9.21E-07 NA mr1623_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105609281 NA 1.97E-15 mr1767_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105609281 NA 1.88E-07 mr1921_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251