Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1105599945:

Variant ID: vg1105599945 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 5599945
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ACATGATTTCTTAACAAAATAAGTCTACTTTCTTTCTCGATAACTGGATGGATAATTACTCATAGGGATGAATTAAATATTTTGTTGTATAAAACTAACA[A/G]
ATAGCTTATAAAAATTATCAAAGAATATCGTTGAAAAACAATCGTAGAGAAATACTTTTTTGAAATTTGAAGCGTAGCATATACTGTCTGGTTAATATTC

Reverse complement sequence

GAATATTAACCAGACAGTATATGCTACGCTTCAAATTTCAAAAAAGTATTTCTCTACGATTGTTTTTCAACGATATTCTTTGATAATTTTTATAAGCTAT[T/C]
TGTTAGTTTTATACAACAAAATATTTAATTCATCCCTATGAGTAATTATCCATCCAGTTATCGAGAAAGAAAGTAGACTTATTTTGTTAAGAAATCATGT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	86.70%	7.40%	2.45%	3.45%	NA
All Indica	2759	91.50%	6.70%	1.74%	0.04%	NA
All Japonica	1512	89.30%	0.10%	0.20%	10.38%	NA
Aus	269	19.70%	56.50%	23.42%	0.37%	NA
Indica I	595	73.80%	21.30%	4.87%	0.00%	NA
Indica II	465	99.80%	0.20%	0.00%	0.00%	NA
Indica III	913	96.90%	2.20%	0.88%	0.00%	NA
Indica Intermediate	786	93.60%	4.80%	1.40%	0.13%	NA
Temperate Japonica	767	91.50%	0.00%	0.39%	8.08%	NA
Tropical Japonica	504	93.10%	0.20%	0.00%	6.75%	NA
Japonica Intermediate	241	74.30%	0.40%	0.00%	25.31%	NA
VI/Aromatic	96	94.80%	1.00%	1.04%	3.12%	NA
Intermediate	90	90.00%	7.80%	1.11%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1105599945	A -> DEL	N	N	silent_mutation	Average:29.871; most accessible tissue: Zhenshan97 root, score: 54.262	N	N	N	N
vg1105599945	A -> G	LOC_Os11g10310.1	intron_variant ; MODIFIER	silent_mutation	Average:29.871; most accessible tissue: Zhenshan97 root, score: 54.262	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1105599945	NA	6.63E-10	mr1004	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105599945	NA	2.59E-09	mr1005	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105599945	NA	4.31E-08	mr1006	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105599945	NA	2.94E-06	mr1007	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105599945	NA	4.71E-08	mr1052	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105599945	NA	2.74E-07	mr1343	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105599945	NA	6.21E-07	mr1758	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105599945	NA	9.85E-14	mr1918	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105599945	NA	9.52E-06	mr1236_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105599945	NA	2.70E-08	mr1378_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105599945	NA	4.18E-10	mr1758_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105599945	NA	1.45E-08	mr1829_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251