\
| Variant ID: vg1105599945 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 5599945 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
ACATGATTTCTTAACAAAATAAGTCTACTTTCTTTCTCGATAACTGGATGGATAATTACTCATAGGGATGAATTAAATATTTTGTTGTATAAAACTAACA[A/G]
ATAGCTTATAAAAATTATCAAAGAATATCGTTGAAAAACAATCGTAGAGAAATACTTTTTTGAAATTTGAAGCGTAGCATATACTGTCTGGTTAATATTC
GAATATTAACCAGACAGTATATGCTACGCTTCAAATTTCAAAAAAGTATTTCTCTACGATTGTTTTTCAACGATATTCTTTGATAATTTTTATAAGCTAT[T/C]
TGTTAGTTTTATACAACAAAATATTTAATTCATCCCTATGAGTAATTATCCATCCAGTTATCGAGAAAGAAAGTAGACTTATTTTGTTAAGAAATCATGT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 86.70% | 7.40% | 2.45% | 3.45% | NA |
| All Indica | 2759 | 91.50% | 6.70% | 1.74% | 0.04% | NA |
| All Japonica | 1512 | 89.30% | 0.10% | 0.20% | 10.38% | NA |
| Aus | 269 | 19.70% | 56.50% | 23.42% | 0.37% | NA |
| Indica I | 595 | 73.80% | 21.30% | 4.87% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 96.90% | 2.20% | 0.88% | 0.00% | NA |
| Indica Intermediate | 786 | 93.60% | 4.80% | 1.40% | 0.13% | NA |
| Temperate Japonica | 767 | 91.50% | 0.00% | 0.39% | 8.08% | NA |
| Tropical Japonica | 504 | 93.10% | 0.20% | 0.00% | 6.75% | NA |
| Japonica Intermediate | 241 | 74.30% | 0.40% | 0.00% | 25.31% | NA |
| VI/Aromatic | 96 | 94.80% | 1.00% | 1.04% | 3.12% | NA |
| Intermediate | 90 | 90.00% | 7.80% | 1.11% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1105599945 | A -> DEL | N | N | silent_mutation | Average:29.871; most accessible tissue: Zhenshan97 root, score: 54.262 | N | N | N | N |
| vg1105599945 | A -> G | LOC_Os11g10310.1 | intron_variant ; MODIFIER | silent_mutation | Average:29.871; most accessible tissue: Zhenshan97 root, score: 54.262 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1105599945 | NA | 6.63E-10 | mr1004 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105599945 | NA | 2.59E-09 | mr1005 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105599945 | NA | 4.31E-08 | mr1006 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105599945 | NA | 2.94E-06 | mr1007 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105599945 | NA | 4.71E-08 | mr1052 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105599945 | NA | 2.74E-07 | mr1343 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105599945 | NA | 6.21E-07 | mr1758 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105599945 | NA | 9.85E-14 | mr1918 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105599945 | NA | 9.52E-06 | mr1236_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105599945 | NA | 2.70E-08 | mr1378_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105599945 | NA | 4.18E-10 | mr1758_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105599945 | NA | 1.45E-08 | mr1829_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |