\
| Variant ID: vg1105587916 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 5587916 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.64, T: 0.37, others allele: 0.00, population size: 281. )
CCAGACAAAGCATGTGCTATCTTTGTAGGCATAAGCATTGCAGGAGCAGTTACTGAGACAAGATTCGGCACATTTGCTTTGAGTGGTAGCATCTTCTATT[T/C]
TTTCGGGGTTAGCTGGCAATGCGACCCGAGTTATTGTGTGGAACATGTCTGTCGAGCTCTTGTTACTAGGGCAATCTAATGGCGTATTTCTGAAGCAACC
GGTTGCTTCAGAAATACGCCATTAGATTGCCCTAGTAACAAGAGCTCGACAGACATGTTCCACACAATAACTCGGGTCGCATTGCCAGCTAACCCCGAAA[A/G]
AATAGAAGATGCTACCACTCAAAGCAAATGTGCCGAATCTTGTCTCAGTAACTGCTCCTGCAATGCTTATGCCTACAAAGATAGCACATGCTTTGTCTGG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 65.70% | 34.30% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 94.70% | 5.30% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 8.10% | 91.90% | 0.00% | 0.00% | NA |
| Aus | 269 | 96.30% | 3.30% | 0.37% | 0.00% | NA |
| Indica I | 595 | 97.50% | 2.50% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| Indica III | 913 | 93.40% | 6.60% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 91.90% | 8.10% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 2.50% | 97.50% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 16.70% | 83.30% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 8.30% | 91.70% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 53.10% | 46.90% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 65.60% | 34.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1105587916 | T -> C | LOC_Os11g10290.1 | missense_variant ; p.Lys394Arg; MODERATE | nonsynonymous_codon ; K394R | Average:61.454; most accessible tissue: Zhenshan97 young leaf, score: 80.589 | benign |
0.116 |
TOLERATED | 0.38 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1105587916 | NA | 1.32E-06 | mr1315 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105587916 | NA | 2.56E-08 | mr1488 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105587916 | NA | 2.15E-07 | mr1604 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105587916 | NA | 2.53E-15 | mr1653 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105587916 | NA | 2.32E-11 | mr1683 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105587916 | NA | 3.42E-52 | mr1692 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105587916 | NA | 2.46E-10 | mr1714 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105587916 | NA | 4.82E-07 | mr1824 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105587916 | NA | 4.03E-23 | mr1838 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105587916 | NA | 1.80E-22 | mr1839 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105587916 | 9.07E-06 | NA | mr1870 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105587916 | NA | 1.11E-17 | mr1968 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105587916 | NA | 3.58E-09 | mr1986 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105587916 | NA | 2.53E-12 | mr1258_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105587916 | NA | 4.43E-19 | mr1276_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105587916 | NA | 1.28E-09 | mr1506_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105587916 | NA | 3.75E-12 | mr1986_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |