\
| Variant ID: vg1105575325 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 5575325 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
ATGCCAATGTTCCTAAAGAAAACAACTCTAAAGCAAATCATCACATTGACCATTGACATTAGCCGAATTACTAATAAACAAAACTTTTATGGTGCAATAA[T/A]
TATGAAATCTATATATTATATGGTGATCCATAAAAACATATACGATTTGGCTTTAAATAAATATCAACGACTCATAAGCCAAATCACACTTCAAACAAAT
ATTTGTTTGAAGTGTGATTTGGCTTATGAGTCGTTGATATTTATTTAAAGCCAAATCGTATATGTTTTTATGGATCACCATATAATATATAGATTTCATA[A/T]
TTATTGCACCATAAAAGTTTTGTTTATTAGTAATTCGGCTAATGTCAATGGTCAATGTGATGATTTGCTTTAGAGTTGTTTTCTTTAGGAACATTGGCAT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 35.00% | 7.60% | 4.89% | 52.56% | NA |
| All Indica | 2759 | 24.10% | 0.30% | 1.63% | 73.94% | NA |
| All Japonica | 1512 | 59.50% | 22.80% | 11.57% | 6.08% | NA |
| Aus | 269 | 4.50% | 0.40% | 0.00% | 95.17% | NA |
| Indica I | 595 | 0.50% | 0.30% | 1.18% | 97.98% | NA |
| Indica II | 465 | 21.70% | 0.60% | 1.72% | 75.91% | NA |
| Indica III | 913 | 42.70% | 0.00% | 1.64% | 55.64% | NA |
| Indica Intermediate | 786 | 21.80% | 0.50% | 1.91% | 75.83% | NA |
| Temperate Japonica | 767 | 42.10% | 38.30% | 17.47% | 2.09% | NA |
| Tropical Japonica | 504 | 79.20% | 2.40% | 5.16% | 13.29% | NA |
| Japonica Intermediate | 241 | 73.90% | 16.20% | 6.22% | 3.73% | NA |
| VI/Aromatic | 96 | 53.10% | 0.00% | 0.00% | 46.88% | NA |
| Intermediate | 90 | 27.80% | 3.30% | 12.22% | 56.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1105575325 | T -> A | LOC_Os11g10270.1 | downstream_gene_variant ; 2644.0bp to feature; MODIFIER | silent_mutation | Average:6.915; most accessible tissue: Callus, score: 19.643 | N | N | N | N |
| vg1105575325 | T -> A | LOC_Os11g10280.1 | downstream_gene_variant ; 4769.0bp to feature; MODIFIER | silent_mutation | Average:6.915; most accessible tissue: Callus, score: 19.643 | N | N | N | N |
| vg1105575325 | T -> A | LOC_Os11g10260.1 | intron_variant ; MODIFIER | silent_mutation | Average:6.915; most accessible tissue: Callus, score: 19.643 | N | N | N | N |
| vg1105575325 | T -> DEL | N | N | silent_mutation | Average:6.915; most accessible tissue: Callus, score: 19.643 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1105575325 | 4.03E-07 | 1.85E-19 | mr1768 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105575325 | NA | 1.13E-06 | mr1768 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105575325 | NA | 5.84E-06 | mr1182_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105575325 | NA | 6.91E-10 | mr1282_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |