\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1105560779:

Variant ID: vg1105560779 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 5560779
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.97, G: 0.02, others allele: 0.00, population size: 119. )

Flanking Sequence (100 bp) in Reference Genome:


TGACCGTTCGTCGTATTTAAGTAATTATTATTTTTTTTCCTATCATTTGATTTATTGTTAAATATACTTTTATGTATACATATAGTTTTACACATTTCAC[G/A]
AAAGTTTTTGAATAAGACGAACGATTAAACATATTTAAAAAAGTCAACGGCGTCAAACATTTAGAGAAGGAGGGAGTATTGATCAGCTGATGCAGTGCAA

Reverse complement sequence

TTGCACTGCATCAGCTGATCAATACTCCCTCCTTCTCTAAATGTTTGACGCCGTTGACTTTTTTAAATATGTTTAATCGTTCGTCTTATTCAAAAACTTT[C/T]
GTGAAATGTGTAAAACTATATGTATACATAAAAGTATATTTAACAATAAATCAAATGATAGGAAAAAAAATAATAATTACTTAAATACGACGAACGGTCA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 75.30% 24.40% 0.17% 0.13% NA
All Indica  2759 98.70% 0.90% 0.22% 0.22% NA
All Japonica  1512 27.00% 73.00% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.70% 0.30% 0.00% 0.00% NA
Indica II  465 97.00% 0.60% 1.08% 1.29% NA
Indica III  913 99.50% 0.50% 0.00% 0.00% NA
Indica Intermediate  786 98.00% 1.90% 0.13% 0.00% NA
Temperate Japonica  767 20.60% 79.40% 0.00% 0.00% NA
Tropical Japonica  504 30.80% 69.20% 0.00% 0.00% NA
Japonica Intermediate  241 39.40% 60.60% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 72.20% 25.60% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1105560779 G -> A LOC_Os11g10240.1 upstream_gene_variant ; 616.0bp to feature; MODIFIER silent_mutation Average:62.737; most accessible tissue: Minghui63 panicle, score: 82.128 N N N N
vg1105560779 G -> A LOC_Os11g10240.2 upstream_gene_variant ; 613.0bp to feature; MODIFIER silent_mutation Average:62.737; most accessible tissue: Minghui63 panicle, score: 82.128 N N N N
vg1105560779 G -> A LOC_Os11g10250.1 downstream_gene_variant ; 2057.0bp to feature; MODIFIER silent_mutation Average:62.737; most accessible tissue: Minghui63 panicle, score: 82.128 N N N N
vg1105560779 G -> A LOC_Os11g10240-LOC_Os11g10250 intergenic_region ; MODIFIER silent_mutation Average:62.737; most accessible tissue: Minghui63 panicle, score: 82.128 N N N N
vg1105560779 G -> DEL N N silent_mutation Average:62.737; most accessible tissue: Minghui63 panicle, score: 82.128 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1105560779 2.90E-06 3.90E-06 mr1931 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251