Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1105560779:

Variant ID: vg1105560779 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 5560779
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.97, G: 0.02, others allele: 0.00, population size: 119. )

Flanking Sequence (100 bp) in Reference Genome:

TGACCGTTCGTCGTATTTAAGTAATTATTATTTTTTTTCCTATCATTTGATTTATTGTTAAATATACTTTTATGTATACATATAGTTTTACACATTTCAC[G/A]
AAAGTTTTTGAATAAGACGAACGATTAAACATATTTAAAAAAGTCAACGGCGTCAAACATTTAGAGAAGGAGGGAGTATTGATCAGCTGATGCAGTGCAA

Reverse complement sequence

TTGCACTGCATCAGCTGATCAATACTCCCTCCTTCTCTAAATGTTTGACGCCGTTGACTTTTTTAAATATGTTTAATCGTTCGTCTTATTCAAAAACTTT[C/T]
GTGAAATGTGTAAAACTATATGTATACATAAAAGTATATTTAACAATAAATCAAATGATAGGAAAAAAAATAATAATTACTTAAATACGACGAACGGTCA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	75.30%	24.40%	0.17%	0.13%	NA
All Indica	2759	98.70%	0.90%	0.22%	0.22%	NA
All Japonica	1512	27.00%	73.00%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.70%	0.30%	0.00%	0.00%	NA
Indica II	465	97.00%	0.60%	1.08%	1.29%	NA
Indica III	913	99.50%	0.50%	0.00%	0.00%	NA
Indica Intermediate	786	98.00%	1.90%	0.13%	0.00%	NA
Temperate Japonica	767	20.60%	79.40%	0.00%	0.00%	NA
Tropical Japonica	504	30.80%	69.20%	0.00%	0.00%	NA
Japonica Intermediate	241	39.40%	60.60%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	72.20%	25.60%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1105560779	G -> A	LOC_Os11g10240.1	upstream_gene_variant ; 616.0bp to feature; MODIFIER	silent_mutation	Average:62.737; most accessible tissue: Minghui63 panicle, score: 82.128	N	N	N	N
vg1105560779	G -> A	LOC_Os11g10240.2	upstream_gene_variant ; 613.0bp to feature; MODIFIER	silent_mutation	Average:62.737; most accessible tissue: Minghui63 panicle, score: 82.128	N	N	N	N
vg1105560779	G -> A	LOC_Os11g10250.1	downstream_gene_variant ; 2057.0bp to feature; MODIFIER	silent_mutation	Average:62.737; most accessible tissue: Minghui63 panicle, score: 82.128	N	N	N	N
vg1105560779	G -> A	LOC_Os11g10240-LOC_Os11g10250	intergenic_region ; MODIFIER	silent_mutation	Average:62.737; most accessible tissue: Minghui63 panicle, score: 82.128	N	N	N	N
vg1105560779	G -> DEL	N	N	silent_mutation	Average:62.737; most accessible tissue: Minghui63 panicle, score: 82.128	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1105560779	2.90E-06	3.90E-06	mr1931	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251