Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1105544417:

Variant ID: vg1105544417 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 5544417
Reference Allele: A	Alternative Allele: T
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TCAAAATGTATGACACCATTAACTTTTCATGTAACGTTTGAAAAAAAAAAGTTAAGGCTATAGTTTGCTTATGATAAAACAAATTAAAAAAATAATATTT[A/T]
TATAATCTTTTTAAAATAATATGAATGACCAAATATCGTATAAAAAAATAACGACATCATATATTTATATATTTCTTTAACAAGTGAGAACAAAACAGAT

Reverse complement sequence

ATCTGTTTTGTTCTCACTTGTTAAAGAAATATATAAATATATGATGTCGTTATTTTTTTATACGATATTTGGTCATTCATATTATTTTAAAAAGATTATA[T/A]
AAATATTATTTTTTTAATTTGTTTTATCATAAGCAAACTATAGCCTTAACTTTTTTTTTTCAAACGTTACATGAAAAGTTAATGGTGTCATACATTTTGA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	90.30%	8.30%	1.42%	0.00%	NA
All Indica	2759	99.40%	0.50%	0.14%	0.00%	NA
All Japonica	1512	71.60%	24.60%	3.84%	0.00%	NA
Aus	269	99.30%	0.00%	0.74%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.80%	0.20%	0.00%	0.00%	NA
Indica III	913	99.70%	0.30%	0.00%	0.00%	NA
Indica Intermediate	786	98.30%	1.10%	0.51%	0.00%	NA
Temperate Japonica	767	93.50%	3.10%	3.39%	0.00%	NA
Tropical Japonica	504	33.90%	61.90%	4.17%	0.00%	NA
Japonica Intermediate	241	80.50%	14.90%	4.56%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	90.00%	6.70%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1105544417	A -> T	LOC_Os11g10210.1	downstream_gene_variant ; 3395.0bp to feature; MODIFIER	silent_mutation	Average:36.693; most accessible tissue: Minghui63 panicle, score: 62.157	N	N	N	N
vg1105544417	A -> T	LOC_Os11g10220.1	downstream_gene_variant ; 2419.0bp to feature; MODIFIER	silent_mutation	Average:36.693; most accessible tissue: Minghui63 panicle, score: 62.157	N	N	N	N
vg1105544417	A -> T	LOC_Os11g10210-LOC_Os11g10220	intergenic_region ; MODIFIER	silent_mutation	Average:36.693; most accessible tissue: Minghui63 panicle, score: 62.157	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1105544417	1.33E-07	NA	mr1076	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105544417	3.09E-07	NA	mr1082	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105544417	NA	1.39E-06	mr1082	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105544417	6.38E-07	NA	mr1083	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105544417	NA	2.50E-07	mr1083	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105544417	3.28E-06	NA	mr1086	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105544417	4.61E-08	NA	mr1103	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105544417	3.29E-07	NA	mr1104	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105544417	1.92E-06	NA	mr1204	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105544417	2.95E-09	NA	mr1226	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105544417	NA	2.39E-06	mr1226	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105544417	NA	5.80E-07	mr1248	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105544417	NA	2.35E-06	mr1364	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105544417	2.62E-07	1.97E-09	mr1408	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105544417	3.25E-10	NA	mr1411	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105544417	8.70E-06	NA	mr1411	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105544417	3.29E-08	NA	mr1560	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105544417	5.83E-08	NA	mr1949	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105544417	2.31E-06	NA	mr1082_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105544417	NA	4.54E-06	mr1082_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105544417	6.15E-08	NA	mr1083_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105544417	NA	2.84E-07	mr1083_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105544417	2.77E-09	NA	mr1103_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105544417	3.01E-10	NA	mr1104_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105544417	1.78E-08	NA	mr1107_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105544417	3.82E-12	NA	mr1226_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105544417	NA	4.54E-08	mr1226_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105544417	NA	6.49E-09	mr1408_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105544417	NA	1.01E-09	mr1769_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251