Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1105526623:

Variant ID: vg1105526623 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 5526623
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATTTTTTGGGTTTGATTGTCACATCGGATATACGGACACACATTTAAAATATTAAACATAGTTTAATAACAAAACAAATTACAAATTCTGCCAGGAAACT[A/G]
CAAGACGAATTTATTAAGCCTAATTAATCTATTATTAGCAAATGTTTACTGTAGCACCGTATTATCAAATCATGGCGCAATTAGGCTCAAAAGATTCGTC

Reverse complement sequence

GACGAATCTTTTGAGCCTAATTGCGCCATGATTTGATAATACGGTGCTACAGTAAACATTTGCTAATAATAGATTAATTAGGCTTAATAAATTCGTCTTG[T/C]
AGTTTCCTGGCAGAATTTGTAATTTGTTTTGTTATTAAACTATGTTTAATATTTTAAATGTGTGTCCGTATATCCGATGTGACAATCAAACCCAAAAAAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	60.30%	39.50%	0.11%	0.00%	NA
All Indica	2759	89.70%	10.20%	0.14%	0.00%	NA
All Japonica	1512	16.10%	83.90%	0.00%	0.00%	NA
Aus	269	12.60%	87.40%	0.00%	0.00%	NA
Indica I	595	73.30%	26.20%	0.50%	0.00%	NA
Indica II	465	97.80%	2.20%	0.00%	0.00%	NA
Indica III	913	96.10%	3.90%	0.00%	0.00%	NA
Indica Intermediate	786	89.80%	10.10%	0.13%	0.00%	NA
Temperate Japonica	767	11.50%	88.50%	0.00%	0.00%	NA
Tropical Japonica	504	24.60%	75.40%	0.00%	0.00%	NA
Japonica Intermediate	241	12.90%	87.10%	0.00%	0.00%	NA
VI/Aromatic	96	49.00%	50.00%	1.04%	0.00%	NA
Intermediate	90	60.00%	40.00%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1105526623	A -> G	LOC_Os11g10190.1	upstream_gene_variant ; 1783.0bp to feature; MODIFIER	silent_mutation	Average:47.181; most accessible tissue: Minghui63 panicle, score: 79.811	N	N	N	N
vg1105526623	A -> G	LOC_Os11g10180.1	downstream_gene_variant ; 4694.0bp to feature; MODIFIER	silent_mutation	Average:47.181; most accessible tissue: Minghui63 panicle, score: 79.811	N	N	N	N
vg1105526623	A -> G	LOC_Os11g10200.1	downstream_gene_variant ; 3451.0bp to feature; MODIFIER	silent_mutation	Average:47.181; most accessible tissue: Minghui63 panicle, score: 79.811	N	N	N	N
vg1105526623	A -> G	LOC_Os11g10190-LOC_Os11g10200	intergenic_region ; MODIFIER	silent_mutation	Average:47.181; most accessible tissue: Minghui63 panicle, score: 79.811	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1105526623	NA	2.27E-17	mr1255	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105526623	NA	4.76E-08	mr1739	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105526623	NA	2.57E-06	mr1128_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105526623	NA	3.30E-20	mr1183_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105526623	NA	6.21E-10	mr1228_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105526623	NA	1.54E-07	mr1376_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105526623	NA	1.66E-06	mr1418_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105526623	NA	1.06E-07	mr1431_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105526623	NA	6.51E-08	mr1659_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105526623	NA	6.60E-12	mr1751_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251