\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1105495945:

Variant ID: vg1105495945 (JBrowse)Variation Type: INDEL
Chromosome: chr11Position: 5495945
Reference Allele: GAlternative Allele: A,GTAA,GTAAGCAACTATTATATAAATTGGTTATTA,GTAAGCAACTATTGTATAAATTGGTTATTA
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGCCAACCGCCGAAAGTTGTTTCTTTTTCTCGTGTCAAGTACTTGCCTGTTGTCCTCTACGAATGTACAATCGACTTTATGATACTCTTTTTTTCCTTTC[G/A,GTAA,GTAAGCAACTATTATATAAATTGGTTATTA,GTAAGCAACTATTGTATAAATTGGTTATTA]
GATGTAAAAGACACGCACATACGAGAACATACGTACGTGCAGGCAGGCTGAGCATGCCTTCTTTAACATGACGAACACACGAACGCTAAGAATAAGATAC

Reverse complement sequence

GTATCTTATTCTTAGCGTTCGTGTGTTCGTCATGTTAAAGAAGGCATGCTCAGCCTGCCTGCACGTACGTATGTTCTCGTATGTGCGTGTCTTTTACATC[C/T,TTAC,TAATAACCAATTTATATAATAGTTGCTTAC,TAATAACCAATTTATACAATAGTTGCTTAC]
GAAAGGAAAAAAAGAGTATCATAAAGTCGATTGTACATTCGTAGAGGACAACAGGCAAGTACTTGACACGAGAAAAAGAAACAACTTTCGGCGGTTGGCG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 29.40% 12.40% 4.25% 53.81% GTAA: 0.08%; GTAAGCAACTATTGTATAAATTGGTTATTA: 0.04%; GTAAGCAACTATTATATAAATTGGTTATTA: 0.04%
All Indica  2759 1.10% 17.50% 6.09% 75.10% GTAA: 0.07%; GTAAGCAACTATTGTATAAATTGGTTATTA: 0.07%; GTAAGCAACTATTATATAAATTGGTTATTA: 0.07%
All Japonica  1512 84.30% 1.70% 0.60% 13.29% GTAA: 0.07%
Aus  269 2.60% 26.00% 5.20% 66.17% NA
Indica I  595 0.50% 14.50% 11.43% 73.61% NA
Indica II  465 1.10% 16.30% 7.96% 74.62% NA
Indica III  913 0.50% 21.80% 2.41% 75.03% GTAA: 0.11%; GTAAGCAACTATTATATAAATTGGTTATTA: 0.11%
Indica Intermediate  786 2.30% 15.40% 5.22% 76.59% GTAAGCAACTATTGTATAAATTGGTTATTA: 0.25%; GTAA: 0.13%; GTAAGCAACTATTATATAAATTGGTTATTA: 0.13%
Temperate Japonica  767 88.90% 0.10% 0.13% 10.82% NA
Tropical Japonica  504 75.80% 4.60% 1.19% 18.25% GTAA: 0.20%
Japonica Intermediate  241 87.60% 0.80% 0.83% 10.79% NA
VI/Aromatic  96 52.10% 0.00% 0.00% 46.88% GTAA: 1.04%
Intermediate  90 27.80% 8.90% 11.11% 52.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1105495945 G -> A LOC_Os11g10140.1 upstream_gene_variant ; 2941.0bp to feature; MODIFIER silent_mutation Average:41.511; most accessible tissue: Callus, score: 64.199 N N N N
vg1105495945 G -> A LOC_Os11g10140-LOC_Os11g10160 intergenic_region ; MODIFIER silent_mutation Average:41.511; most accessible tissue: Callus, score: 64.199 N N N N
vg1105495945 G -> DEL N N silent_mutation Average:41.511; most accessible tissue: Callus, score: 64.199 N N N N
vg1105495945 G -> GTAA LOC_Os11g10140.1 upstream_gene_variant ; 2942.0bp to feature; MODIFIER silent_mutation Average:41.511; most accessible tissue: Callus, score: 64.199 N N N N
vg1105495945 G -> GTAA LOC_Os11g10140-LOC_Os11g10160 intergenic_region ; MODIFIER silent_mutation Average:41.511; most accessible tissue: Callus, score: 64.199 N N N N
vg1105495945 G -> GTAAGCAACTATTATATAAATTGGTTATTA LOC_Os11g10140.1 upstream_gene_variant ; 2942.0bp to feature; MODIFIER silent_mutation Average:41.511; most accessible tissue: Callus, score: 64.199 N N N N
vg1105495945 G -> GTAAGCAACTATTATATAAATTGGTTATTA LOC_Os11g10140-LOC_Os11g10160 intergenic_region ; MODIFIER silent_mutation Average:41.511; most accessible tissue: Callus, score: 64.199 N N N N
vg1105495945 G -> GTAAGCAACTATTGTATAAATTGGTTATTA LOC_Os11g10140.1 upstream_gene_variant ; 2942.0bp to feature; MODIFIER silent_mutation Average:41.511; most accessible tissue: Callus, score: 64.199 N N N N
vg1105495945 G -> GTAAGCAACTATTGTATAAATTGGTTATTA LOC_Os11g10140-LOC_Os11g10160 intergenic_region ; MODIFIER silent_mutation Average:41.511; most accessible tissue: Callus, score: 64.199 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1105495945 NA 6.15E-07 mr1315 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105495945 NA 1.06E-09 mr1336 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105495945 8.35E-07 6.03E-09 mr1336 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105495945 NA 1.83E-06 mr1392 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105495945 NA 8.21E-09 mr1439 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105495945 NA 8.78E-14 mr1521 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105495945 NA 2.81E-07 mr1779 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105495945 NA 1.30E-06 mr1979 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251