\
| Variant ID: vg1105495945 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr11 | Position: 5495945 |
| Reference Allele: G | Alternative Allele: A,GTAA,GTAAGCAACTATTATATAAATTGGTTATTA,GTAAGCAACTATTGTATAAATTGGTTATTA |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CGCCAACCGCCGAAAGTTGTTTCTTTTTCTCGTGTCAAGTACTTGCCTGTTGTCCTCTACGAATGTACAATCGACTTTATGATACTCTTTTTTTCCTTTC[G/A,GTAA,GTAAGCAACTATTATATAAATTGGTTATTA,GTAAGCAACTATTGTATAAATTGGTTATTA]
GATGTAAAAGACACGCACATACGAGAACATACGTACGTGCAGGCAGGCTGAGCATGCCTTCTTTAACATGACGAACACACGAACGCTAAGAATAAGATAC
GTATCTTATTCTTAGCGTTCGTGTGTTCGTCATGTTAAAGAAGGCATGCTCAGCCTGCCTGCACGTACGTATGTTCTCGTATGTGCGTGTCTTTTACATC[C/T,TTAC,TAATAACCAATTTATATAATAGTTGCTTAC,TAATAACCAATTTATACAATAGTTGCTTAC]
GAAAGGAAAAAAAGAGTATCATAAAGTCGATTGTACATTCGTAGAGGACAACAGGCAAGTACTTGACACGAGAAAAAGAAACAACTTTCGGCGGTTGGCG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 29.40% | 12.40% | 4.25% | 53.81% | GTAA: 0.08%; GTAAGCAACTATTGTATAAATTGGTTATTA: 0.04%; GTAAGCAACTATTATATAAATTGGTTATTA: 0.04% |
| All Indica | 2759 | 1.10% | 17.50% | 6.09% | 75.10% | GTAA: 0.07%; GTAAGCAACTATTGTATAAATTGGTTATTA: 0.07%; GTAAGCAACTATTATATAAATTGGTTATTA: 0.07% |
| All Japonica | 1512 | 84.30% | 1.70% | 0.60% | 13.29% | GTAA: 0.07% |
| Aus | 269 | 2.60% | 26.00% | 5.20% | 66.17% | NA |
| Indica I | 595 | 0.50% | 14.50% | 11.43% | 73.61% | NA |
| Indica II | 465 | 1.10% | 16.30% | 7.96% | 74.62% | NA |
| Indica III | 913 | 0.50% | 21.80% | 2.41% | 75.03% | GTAA: 0.11%; GTAAGCAACTATTATATAAATTGGTTATTA: 0.11% |
| Indica Intermediate | 786 | 2.30% | 15.40% | 5.22% | 76.59% | GTAAGCAACTATTGTATAAATTGGTTATTA: 0.25%; GTAA: 0.13%; GTAAGCAACTATTATATAAATTGGTTATTA: 0.13% |
| Temperate Japonica | 767 | 88.90% | 0.10% | 0.13% | 10.82% | NA |
| Tropical Japonica | 504 | 75.80% | 4.60% | 1.19% | 18.25% | GTAA: 0.20% |
| Japonica Intermediate | 241 | 87.60% | 0.80% | 0.83% | 10.79% | NA |
| VI/Aromatic | 96 | 52.10% | 0.00% | 0.00% | 46.88% | GTAA: 1.04% |
| Intermediate | 90 | 27.80% | 8.90% | 11.11% | 52.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1105495945 | G -> A | LOC_Os11g10140.1 | upstream_gene_variant ; 2941.0bp to feature; MODIFIER | silent_mutation | Average:41.511; most accessible tissue: Callus, score: 64.199 | N | N | N | N |
| vg1105495945 | G -> A | LOC_Os11g10140-LOC_Os11g10160 | intergenic_region ; MODIFIER | silent_mutation | Average:41.511; most accessible tissue: Callus, score: 64.199 | N | N | N | N |
| vg1105495945 | G -> DEL | N | N | silent_mutation | Average:41.511; most accessible tissue: Callus, score: 64.199 | N | N | N | N |
| vg1105495945 | G -> GTAA | LOC_Os11g10140.1 | upstream_gene_variant ; 2942.0bp to feature; MODIFIER | silent_mutation | Average:41.511; most accessible tissue: Callus, score: 64.199 | N | N | N | N |
| vg1105495945 | G -> GTAA | LOC_Os11g10140-LOC_Os11g10160 | intergenic_region ; MODIFIER | silent_mutation | Average:41.511; most accessible tissue: Callus, score: 64.199 | N | N | N | N |
| vg1105495945 | G -> GTAAGCAACTATTATATAAATTGGTTATTA | LOC_Os11g10140.1 | upstream_gene_variant ; 2942.0bp to feature; MODIFIER | silent_mutation | Average:41.511; most accessible tissue: Callus, score: 64.199 | N | N | N | N |
| vg1105495945 | G -> GTAAGCAACTATTATATAAATTGGTTATTA | LOC_Os11g10140-LOC_Os11g10160 | intergenic_region ; MODIFIER | silent_mutation | Average:41.511; most accessible tissue: Callus, score: 64.199 | N | N | N | N |
| vg1105495945 | G -> GTAAGCAACTATTGTATAAATTGGTTATTA | LOC_Os11g10140.1 | upstream_gene_variant ; 2942.0bp to feature; MODIFIER | silent_mutation | Average:41.511; most accessible tissue: Callus, score: 64.199 | N | N | N | N |
| vg1105495945 | G -> GTAAGCAACTATTGTATAAATTGGTTATTA | LOC_Os11g10140-LOC_Os11g10160 | intergenic_region ; MODIFIER | silent_mutation | Average:41.511; most accessible tissue: Callus, score: 64.199 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1105495945 | NA | 6.15E-07 | mr1315 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105495945 | NA | 1.06E-09 | mr1336 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105495945 | 8.35E-07 | 6.03E-09 | mr1336 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105495945 | NA | 1.83E-06 | mr1392 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105495945 | NA | 8.21E-09 | mr1439 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105495945 | NA | 8.78E-14 | mr1521 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105495945 | NA | 2.81E-07 | mr1779 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105495945 | NA | 1.30E-06 | mr1979 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |