\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1105470288:

Variant ID: vg1105470288 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 5470288
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.01, others allele: 0.00, population size: 126. )

Flanking Sequence (100 bp) in Reference Genome:


AGCCTCCCATCGTTTGCTGTTGTCAAATTTTGAATTTAAAAGTTAATTTTGGAGTTGATTTTGGGGTTTTTTTCATCGTAGTTTCTTACTTTCTTTTCCT[G/A]
AATTAGCTTTTAAATCACTAAGAACATATATATAAAAGTTTTATCTAGGAATTATTTTTTGGTTGCTGATAAGTTGTTCTACAGATTAACATAACAGAAT

Reverse complement sequence

ATTCTGTTATGTTAATCTGTAGAACAACTTATCAGCAACCAAAAAATAATTCCTAGATAAAACTTTTATATATATGTTCTTAGTGATTTAAAAGCTAATT[C/T]
AGGAAAAGAAAGTAAGAAACTACGATGAAAAAAACCCCAAAATCAACTCCAAAATTAACTTTTAAATTCAAAATTTGACAACAGCAAACGATGGGAGGCT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.60% 25.20% 0.21% 0.00% NA
All Indica  2759 58.20% 41.50% 0.33% 0.00% NA
All Japonica  1512 98.50% 1.40% 0.07% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 45.20% 54.60% 0.17% 0.00% NA
Indica II  465 29.00% 70.80% 0.22% 0.00% NA
Indica III  913 77.70% 22.00% 0.33% 0.00% NA
Indica Intermediate  786 62.70% 36.80% 0.51% 0.00% NA
Temperate Japonica  767 97.80% 2.20% 0.00% 0.00% NA
Tropical Japonica  504 99.60% 0.20% 0.20% 0.00% NA
Japonica Intermediate  241 98.80% 1.20% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 70.00% 30.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1105470288 G -> A LOC_Os11g10110.1 upstream_gene_variant ; 3982.0bp to feature; MODIFIER silent_mutation Average:67.892; most accessible tissue: Zhenshan97 root, score: 82.733 N N N N
vg1105470288 G -> A LOC_Os11g10120.1 upstream_gene_variant ; 1005.0bp to feature; MODIFIER silent_mutation Average:67.892; most accessible tissue: Zhenshan97 root, score: 82.733 N N N N
vg1105470288 G -> A LOC_Os11g10120-LOC_Os11g10130 intergenic_region ; MODIFIER silent_mutation Average:67.892; most accessible tissue: Zhenshan97 root, score: 82.733 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1105470288 NA 2.88E-08 mr1063_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105470288 NA 8.92E-06 mr1169_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105470288 NA 7.54E-08 mr1215_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105470288 NA 5.34E-09 mr1220_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105470288 NA 9.85E-06 mr1277_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105470288 NA 1.18E-06 mr1330_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105470288 NA 2.09E-08 mr1510_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105470288 NA 4.33E-07 mr1517_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105470288 NA 5.61E-06 mr1567_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105470288 NA 1.63E-06 mr1624_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105470288 NA 4.63E-06 mr1702_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105470288 NA 6.75E-06 mr1743_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105470288 NA 6.69E-10 mr1751_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105470288 NA 3.61E-10 mr1806_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105470288 4.84E-06 1.12E-09 mr1806_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105470288 NA 9.53E-19 mr1870_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251