\
| Variant ID: vg1105470288 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 5470288 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.01, others allele: 0.00, population size: 126. )
AGCCTCCCATCGTTTGCTGTTGTCAAATTTTGAATTTAAAAGTTAATTTTGGAGTTGATTTTGGGGTTTTTTTCATCGTAGTTTCTTACTTTCTTTTCCT[G/A]
AATTAGCTTTTAAATCACTAAGAACATATATATAAAAGTTTTATCTAGGAATTATTTTTTGGTTGCTGATAAGTTGTTCTACAGATTAACATAACAGAAT
ATTCTGTTATGTTAATCTGTAGAACAACTTATCAGCAACCAAAAAATAATTCCTAGATAAAACTTTTATATATATGTTCTTAGTGATTTAAAAGCTAATT[C/T]
AGGAAAAGAAAGTAAGAAACTACGATGAAAAAAACCCCAAAATCAACTCCAAAATTAACTTTTAAATTCAAAATTTGACAACAGCAAACGATGGGAGGCT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 74.60% | 25.20% | 0.21% | 0.00% | NA |
| All Indica | 2759 | 58.20% | 41.50% | 0.33% | 0.00% | NA |
| All Japonica | 1512 | 98.50% | 1.40% | 0.07% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 45.20% | 54.60% | 0.17% | 0.00% | NA |
| Indica II | 465 | 29.00% | 70.80% | 0.22% | 0.00% | NA |
| Indica III | 913 | 77.70% | 22.00% | 0.33% | 0.00% | NA |
| Indica Intermediate | 786 | 62.70% | 36.80% | 0.51% | 0.00% | NA |
| Temperate Japonica | 767 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.60% | 0.20% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 70.00% | 30.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1105470288 | G -> A | LOC_Os11g10110.1 | upstream_gene_variant ; 3982.0bp to feature; MODIFIER | silent_mutation | Average:67.892; most accessible tissue: Zhenshan97 root, score: 82.733 | N | N | N | N |
| vg1105470288 | G -> A | LOC_Os11g10120.1 | upstream_gene_variant ; 1005.0bp to feature; MODIFIER | silent_mutation | Average:67.892; most accessible tissue: Zhenshan97 root, score: 82.733 | N | N | N | N |
| vg1105470288 | G -> A | LOC_Os11g10120-LOC_Os11g10130 | intergenic_region ; MODIFIER | silent_mutation | Average:67.892; most accessible tissue: Zhenshan97 root, score: 82.733 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1105470288 | NA | 2.88E-08 | mr1063_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105470288 | NA | 8.92E-06 | mr1169_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105470288 | NA | 7.54E-08 | mr1215_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105470288 | NA | 5.34E-09 | mr1220_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105470288 | NA | 9.85E-06 | mr1277_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105470288 | NA | 1.18E-06 | mr1330_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105470288 | NA | 2.09E-08 | mr1510_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105470288 | NA | 4.33E-07 | mr1517_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105470288 | NA | 5.61E-06 | mr1567_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105470288 | NA | 1.63E-06 | mr1624_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105470288 | NA | 4.63E-06 | mr1702_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105470288 | NA | 6.75E-06 | mr1743_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105470288 | NA | 6.69E-10 | mr1751_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105470288 | NA | 3.61E-10 | mr1806_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105470288 | 4.84E-06 | 1.12E-09 | mr1806_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105470288 | NA | 9.53E-19 | mr1870_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |