\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1105453065:

Variant ID: vg1105453065 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 5453065
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.91, T: 0.08, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


TAGAAAATCATGAGCTGCAATTAGAAGTCCGATCATATTAAGTTAGCATGCGAGTTTTTTAAAGAGAATTCTTATACGACTCTTATTATATTTTCAAAAG[C/T]
GAACGAACTTAAAACCGACTCAAATACAGATATGTATTTCCGAAAGCGATCAAACTTAAAAACCGACTAATACACGGATGACTTACCAAAGTACTGGTAA

Reverse complement sequence

TTACCAGTACTTTGGTAAGTCATCCGTGTATTAGTCGGTTTTTAAGTTTGATCGCTTTCGGAAATACATATCTGTATTTGAGTCGGTTTTAAGTTCGTTC[G/A]
CTTTTGAAAATATAATAAGAGTCGTATAAGAATTCTCTTTAAAAAACTCGCATGCTAACTTAATATGATCGGACTTCTAATTGCAGCTCATGATTTTCTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.50% 40.40% 0.13% 0.00% NA
All Indica  2759 37.50% 62.30% 0.18% 0.00% NA
All Japonica  1512 90.40% 9.60% 0.00% 0.00% NA
Aus  269 96.30% 3.70% 0.00% 0.00% NA
Indica I  595 45.00% 54.80% 0.17% 0.00% NA
Indica II  465 11.20% 88.60% 0.22% 0.00% NA
Indica III  913 40.40% 59.60% 0.00% 0.00% NA
Indica Intermediate  786 44.10% 55.50% 0.38% 0.00% NA
Temperate Japonica  767 97.30% 2.70% 0.00% 0.00% NA
Tropical Japonica  504 79.00% 21.00% 0.00% 0.00% NA
Japonica Intermediate  241 92.50% 7.50% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 61.10% 37.80% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1105453065 C -> T LOC_Os11g10090.1 downstream_gene_variant ; 4487.0bp to feature; MODIFIER silent_mutation Average:60.706; most accessible tissue: Minghui63 panicle, score: 78.92 N N N N
vg1105453065 C -> T LOC_Os11g10090-LOC_Os11g10100 intergenic_region ; MODIFIER silent_mutation Average:60.706; most accessible tissue: Minghui63 panicle, score: 78.92 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1105453065 NA 2.55E-09 mr1352 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105453065 NA 1.50E-08 mr1063_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105453065 NA 2.47E-06 mr1169_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105453065 NA 6.50E-08 mr1215_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105453065 NA 1.83E-07 mr1302_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105453065 NA 5.56E-06 mr1320_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105453065 NA 2.39E-06 mr1323_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105453065 NA 1.71E-07 mr1330_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105453065 NA 6.24E-06 mr1366_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105453065 NA 9.17E-08 mr1376_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105453065 NA 5.11E-06 mr1381_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105453065 NA 6.91E-08 mr1431_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105453065 NA 1.03E-06 mr1500_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105453065 2.63E-06 1.37E-10 mr1510_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105453065 NA 8.02E-07 mr1517_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105453065 NA 7.59E-06 mr1545_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105453065 NA 1.46E-06 mr1550_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105453065 NA 8.05E-06 mr1567_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105453065 NA 1.90E-06 mr1659_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105453065 NA 2.14E-07 mr1702_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105453065 NA 4.32E-06 mr1714_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105453065 NA 6.69E-06 mr1743_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105453065 NA 1.13E-09 mr1751_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105453065 NA 5.08E-08 mr1806_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251