\
| Variant ID: vg1105453065 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 5453065 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.91, T: 0.08, others allele: 0.00, population size: 103. )
TAGAAAATCATGAGCTGCAATTAGAAGTCCGATCATATTAAGTTAGCATGCGAGTTTTTTAAAGAGAATTCTTATACGACTCTTATTATATTTTCAAAAG[C/T]
GAACGAACTTAAAACCGACTCAAATACAGATATGTATTTCCGAAAGCGATCAAACTTAAAAACCGACTAATACACGGATGACTTACCAAAGTACTGGTAA
TTACCAGTACTTTGGTAAGTCATCCGTGTATTAGTCGGTTTTTAAGTTTGATCGCTTTCGGAAATACATATCTGTATTTGAGTCGGTTTTAAGTTCGTTC[G/A]
CTTTTGAAAATATAATAAGAGTCGTATAAGAATTCTCTTTAAAAAACTCGCATGCTAACTTAATATGATCGGACTTCTAATTGCAGCTCATGATTTTCTA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 59.50% | 40.40% | 0.13% | 0.00% | NA |
| All Indica | 2759 | 37.50% | 62.30% | 0.18% | 0.00% | NA |
| All Japonica | 1512 | 90.40% | 9.60% | 0.00% | 0.00% | NA |
| Aus | 269 | 96.30% | 3.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 45.00% | 54.80% | 0.17% | 0.00% | NA |
| Indica II | 465 | 11.20% | 88.60% | 0.22% | 0.00% | NA |
| Indica III | 913 | 40.40% | 59.60% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 44.10% | 55.50% | 0.38% | 0.00% | NA |
| Temperate Japonica | 767 | 97.30% | 2.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 79.00% | 21.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 92.50% | 7.50% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 61.10% | 37.80% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1105453065 | C -> T | LOC_Os11g10090.1 | downstream_gene_variant ; 4487.0bp to feature; MODIFIER | silent_mutation | Average:60.706; most accessible tissue: Minghui63 panicle, score: 78.92 | N | N | N | N |
| vg1105453065 | C -> T | LOC_Os11g10090-LOC_Os11g10100 | intergenic_region ; MODIFIER | silent_mutation | Average:60.706; most accessible tissue: Minghui63 panicle, score: 78.92 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1105453065 | NA | 2.55E-09 | mr1352 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105453065 | NA | 1.50E-08 | mr1063_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105453065 | NA | 2.47E-06 | mr1169_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105453065 | NA | 6.50E-08 | mr1215_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105453065 | NA | 1.83E-07 | mr1302_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105453065 | NA | 5.56E-06 | mr1320_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105453065 | NA | 2.39E-06 | mr1323_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105453065 | NA | 1.71E-07 | mr1330_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105453065 | NA | 6.24E-06 | mr1366_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105453065 | NA | 9.17E-08 | mr1376_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105453065 | NA | 5.11E-06 | mr1381_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105453065 | NA | 6.91E-08 | mr1431_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105453065 | NA | 1.03E-06 | mr1500_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105453065 | 2.63E-06 | 1.37E-10 | mr1510_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105453065 | NA | 8.02E-07 | mr1517_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105453065 | NA | 7.59E-06 | mr1545_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105453065 | NA | 1.46E-06 | mr1550_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105453065 | NA | 8.05E-06 | mr1567_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105453065 | NA | 1.90E-06 | mr1659_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105453065 | NA | 2.14E-07 | mr1702_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105453065 | NA | 4.32E-06 | mr1714_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105453065 | NA | 6.69E-06 | mr1743_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105453065 | NA | 1.13E-09 | mr1751_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105453065 | NA | 5.08E-08 | mr1806_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |