\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1105433765:

Variant ID: vg1105433765 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 5433765
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTATCTCCATCCTCTCCATCCTTCTCCTTCCATCCTCCCCTTGCTCTTCTCTCACCCCCTTTCCTCCTCCCCTCCCCTTCCTTCCCTTGCAGAGGCAGCC[A/G]
GCGGCGGGATGGAGGCCGGGCGCGGGCTGGCGGCGGGATGGAGGCCGGGCGTGGGCCAGCGGGATGGAGGCCGGCCGGTGGCGGCCCGGCGCGGGCCAAC

Reverse complement sequence

GTTGGCCCGCGCCGGGCCGCCACCGGCCGGCCTCCATCCCGCTGGCCCACGCCCGGCCTCCATCCCGCCGCCAGCCCGCGCCCGGCCTCCATCCCGCCGC[T/C]
GGCTGCCTCTGCAAGGGAAGGAAGGGGAGGGGAGGAGGAAAGGGGGTGAGAGAAGAGCAAGGGGAGGATGGAAGGAGAAGGATGGAGAGGATGGAGATAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 70.00% 11.00% 13.77% 5.23% NA
All Indica  2759 68.40% 0.50% 22.47% 8.70% NA
All Japonica  1512 69.90% 29.00% 0.86% 0.26% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 60.00% 0.30% 33.28% 6.39% NA
Indica II  465 37.00% 0.00% 42.58% 20.43% NA
Indica III  913 86.60% 0.10% 8.32% 4.93% NA
Indica Intermediate  786 72.00% 1.30% 18.83% 7.89% NA
Temperate Japonica  767 67.90% 30.40% 1.17% 0.52% NA
Tropical Japonica  504 80.40% 19.60% 0.00% 0.00% NA
Japonica Intermediate  241 54.40% 44.00% 1.66% 0.00% NA
VI/Aromatic  96 42.70% 57.30% 0.00% 0.00% NA
Intermediate  90 63.30% 13.30% 20.00% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1105433765 A -> DEL N N silent_mutation Average:71.465; most accessible tissue: Minghui63 young leaf, score: 85.437 N N N N
vg1105433765 A -> G LOC_Os11g10080.1 upstream_gene_variant ; 3120.0bp to feature; MODIFIER silent_mutation Average:71.465; most accessible tissue: Minghui63 young leaf, score: 85.437 N N N N
vg1105433765 A -> G LOC_Os11g10070-LOC_Os11g10080 intergenic_region ; MODIFIER silent_mutation Average:71.465; most accessible tissue: Minghui63 young leaf, score: 85.437 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1105433765 A G -0.01 -0.01 -0.01 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1105433765 4.99E-06 NA mr1107 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105433765 NA 1.82E-07 mr1184 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105433765 NA 5.31E-06 mr1209 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105433765 NA 1.27E-06 mr1215 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105433765 5.72E-06 NA mr1287 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105433765 NA 4.01E-06 mr1293 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105433765 NA 2.51E-07 mr1315 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105433765 3.24E-06 NA mr1372 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105433765 NA 3.49E-06 mr1374 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105433765 6.73E-06 NA mr1432 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105433765 3.56E-06 NA mr1700 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105433765 NA 7.99E-06 mr1791 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105433765 NA 3.18E-07 mr1810 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251