\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1105430197:

Variant ID: vg1105430197 (JBrowse)Variation Type: INDEL
Chromosome: chr11Position: 5430197
Reference Allele: TAAAAlternative Allele: AAAA,TAA,TA,TAAAAA,T,TAAAAAAA
Primary Allele: TAAASecondary Allele: TAA

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CACATAGCACGTCCTTAATCACCGGAATCAATCTTCACGCACAATAACAGCAGGCGTACTTGCTTTGCATCTGGATAGATCGATAGTTTGTTTTTTTTTT[TAAA/AAAA,TAA,TA,TAAAAA,T,TAAAAAAA]
AAAAAAAGTAACGGAGGAACGCTAACTTGCGTCATGGAAGGGCCTGGCATTGTTGGGCCTTGCACACAAAGCATACGTCTTAGCATGAAAGGAATTTAAA

Reverse complement sequence

TTTAAATTCCTTTCATGCTAAGACGTATGCTTTGTGTGCAAGGCCCAACAATGCCAGGCCCTTCCATGACGCAAGTTAGCGTTCCTCCGTTACTTTTTTT[TTTA/TTTT,TTA,TA,TTTTTA,A,TTTTTTTA]
AAAAAAAAAACAAACTATCGATCTATCCAGATGCAAAGCAAGTACGCCTGCTGTTATTGTGCGTGAAGATTGATTCCGGTGATTAAGGACGTGCTATGTG

Allele Frequencies:

Populations Population SizeFrequency of TAAA(primary allele) Frequency of TAA(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 47.60% 23.20% 5.90% 0.00% AAAA: 12.19%; TA: 10.96%; T: 0.08%; TAAAAA: 0.04%; TAAAAAAA: 0.02%
All Indica  2759 55.60% 0.90% 6.92% 0.00% AAAA: 18.70%; TA: 17.69%; T: 0.11%
All Japonica  1512 25.80% 66.30% 3.97% 0.00% AAAA: 2.51%; TA: 1.32%; TAAAAA: 0.07%; T: 0.07%
Aus  269 94.10% 1.90% 2.97% 0.00% TA: 0.74%; AAAA: 0.37%
Indica I  595 29.10% 0.00% 9.08% 0.00% AAAA: 47.73%; TA: 14.12%
Indica II  465 78.50% 0.60% 5.81% 0.00% AAAA: 7.96%; TA: 7.10%
Indica III  913 61.30% 1.20% 3.94% 0.00% TA: 23.22%; AAAA: 9.97%; T: 0.33%
Indica Intermediate  786 55.60% 1.50% 9.41% 0.00% TA: 20.23%; AAAA: 13.23%
Temperate Japonica  767 25.90% 67.70% 4.82% 0.00% AAAA: 1.04%; TA: 0.39%; TAAAAA: 0.13%
Tropical Japonica  504 26.80% 62.90% 2.18% 0.00% AAAA: 4.76%; TA: 3.17%; T: 0.20%
Japonica Intermediate  241 23.20% 68.90% 4.98% 0.00% AAAA: 2.49%; TA: 0.41%
VI/Aromatic  96 24.00% 49.00% 11.46% 0.00% AAAA: 13.54%; TAAAAA: 1.04%; TAAAAAAA: 1.04%
Intermediate  90 54.40% 17.80% 10.00% 0.00% TA: 8.89%; AAAA: 8.89%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1105430197 TAAA -> TA LOC_Os11g10070.1 downstream_gene_variant ; 3022.0bp to feature; MODIFIER silent_mutation Average:84.314; most accessible tissue: Callus, score: 95.833 N N N N
vg1105430197 TAAA -> TA LOC_Os11g10070-LOC_Os11g10080 intergenic_region ; MODIFIER silent_mutation Average:84.314; most accessible tissue: Callus, score: 95.833 N N N N
vg1105430197 TAAA -> T LOC_Os11g10070.1 downstream_gene_variant ; 3021.0bp to feature; MODIFIER silent_mutation Average:84.314; most accessible tissue: Callus, score: 95.833 N N N N
vg1105430197 TAAA -> T LOC_Os11g10070-LOC_Os11g10080 intergenic_region ; MODIFIER silent_mutation Average:84.314; most accessible tissue: Callus, score: 95.833 N N N N
vg1105430197 TAAA -> TAAAAA LOC_Os11g10070.1 downstream_gene_variant ; 3024.0bp to feature; MODIFIER silent_mutation Average:84.314; most accessible tissue: Callus, score: 95.833 N N N N
vg1105430197 TAAA -> TAAAAA LOC_Os11g10070-LOC_Os11g10080 intergenic_region ; MODIFIER silent_mutation Average:84.314; most accessible tissue: Callus, score: 95.833 N N N N
vg1105430197 TAAA -> TAAAAAAA LOC_Os11g10070.1 downstream_gene_variant ; 3024.0bp to feature; MODIFIER silent_mutation Average:84.314; most accessible tissue: Callus, score: 95.833 N N N N
vg1105430197 TAAA -> TAAAAAAA LOC_Os11g10070-LOC_Os11g10080 intergenic_region ; MODIFIER silent_mutation Average:84.314; most accessible tissue: Callus, score: 95.833 N N N N
vg1105430197 TAAA -> TAA LOC_Os11g10070.1 downstream_gene_variant ; 3023.0bp to feature; MODIFIER silent_mutation Average:84.314; most accessible tissue: Callus, score: 95.833 N N N N
vg1105430197 TAAA -> TAA LOC_Os11g10070-LOC_Os11g10080 intergenic_region ; MODIFIER silent_mutation Average:84.314; most accessible tissue: Callus, score: 95.833 N N N N
vg1105430197 TAAA -> AAAA LOC_Os11g10070.1 downstream_gene_variant ; 3020.0bp to feature; MODIFIER silent_mutation Average:84.314; most accessible tissue: Callus, score: 95.833 N N N N
vg1105430197 TAAA -> AAAA LOC_Os11g10070-LOC_Os11g10080 intergenic_region ; MODIFIER silent_mutation Average:84.314; most accessible tissue: Callus, score: 95.833 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1105430197 TAAA AAAA -0.02 0.0 0.01 0.0 0.0 0.0
vg1105430197 TAAA T -0.24 -0.24 -0.26 -0.01 0.02 0.05
vg1105430197 TAAA TA 0.02 -0.09 -0.16 0.02 0.1 0.13
vg1105430197 TAAA TAA 0.12 0.07 0.02 0.08 0.09 0.11
vg1105430197 TAAA TAAAA* 0.18 0.09 0.06 0.06 0.23 0.33

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1105430197 NA 1.84E-06 mr1038 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105430197 8.45E-06 8.49E-07 mr1389 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105430197 4.98E-08 2.61E-08 mr1038_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105430197 6.01E-07 NA mr1141_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105430197 3.38E-07 8.20E-08 mr1389_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105430197 8.20E-06 1.51E-06 mr1679_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251