\
| Variant ID: vg1105314883 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 5314883 |
| Reference Allele: G | Alternative Allele: C |
| Primary Allele: G | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
GCTTACTATCAATGTAGCCAAAGCGATTCAAGATCTTCTCCACATAATGGGACTGCAAGAGTGTAATCACATTCTCACCTCTAATTAGCTTAATGTTTAA[G/C]
ATAACATCAGCTACTCCCAAATCCTTCATATCAAAATTTTGAGACAAGAATAATTTAACCTCGTTTATCACCTCAAGGTTTGTCCCAAATATCAGTATGT
ACATACTGATATTTGGGACAAACCTTGAGGTGATAAACGAGGTTAAATTATTCTTGTCTCAAAATTTTGATATGAAGGATTTGGGAGTAGCTGATGTTAT[C/G]
TTAAACATTAAGCTAATTAGAGGTGAGAATGTGATTACACTCTTGCAGTCCCATTATGTGGAGAAGATCTTGAATCGCTTTGGCTACATTGATAGTAAGC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 20.90% | 16.50% | 3.13% | 59.52% | NA |
| All Indica | 2759 | 27.60% | 8.40% | 3.23% | 60.78% | NA |
| All Japonica | 1512 | 11.20% | 35.40% | 1.46% | 51.98% | NA |
| Aus | 269 | 6.30% | 0.00% | 11.15% | 82.53% | NA |
| Indica I | 595 | 22.50% | 4.90% | 3.36% | 69.24% | NA |
| Indica II | 465 | 11.60% | 3.70% | 4.09% | 80.65% | NA |
| Indica III | 913 | 39.50% | 7.00% | 2.63% | 50.82% | NA |
| Indica Intermediate | 786 | 27.00% | 15.50% | 3.31% | 54.20% | NA |
| Temperate Japonica | 767 | 17.70% | 57.90% | 0.00% | 24.38% | NA |
| Tropical Japonica | 504 | 4.40% | 7.90% | 3.37% | 84.33% | NA |
| Japonica Intermediate | 241 | 4.60% | 21.20% | 2.07% | 72.20% | NA |
| VI/Aromatic | 96 | 14.60% | 3.10% | 0.00% | 82.29% | NA |
| Intermediate | 90 | 28.90% | 8.90% | 7.78% | 54.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1105314883 | G -> DEL | LOC_Os11g09919.1 | N | frameshift_variant | Average:8.151; most accessible tissue: Minghui63 root, score: 13.235 | N | N | N | N |
| vg1105314883 | G -> C | LOC_Os11g09919.1 | missense_variant ; p.Ile523Met; MODERATE | nonsynonymous_codon ; I523M | Average:8.151; most accessible tissue: Minghui63 root, score: 13.235 | probably damaging |
2.494 |
DELETERIOUS | 0.00 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1105314883 | NA | 3.17E-07 | mr1153_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105314883 | NA | 6.89E-07 | mr1262_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105314883 | NA | 2.38E-07 | mr1266_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105314883 | 9.15E-06 | 9.10E-06 | mr1413_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105314883 | NA | 6.67E-06 | mr1624_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105314883 | NA | 3.22E-06 | mr1646_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105314883 | NA | 4.65E-07 | mr1662_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105314883 | NA | 1.10E-08 | mr1681_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105314883 | NA | 8.53E-08 | mr1909_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105314883 | NA | 1.95E-07 | mr1921_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |