Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1105283911:

Variant ID: vg1105283911 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 5283911
Reference Allele: G	Alternative Allele: C
Primary Allele: C	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.93, C: 0.07, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:

ACAGAAGAAAAAGCAGAGCTCACAGATTTTCCTCACTTTCCATTGAAGTTTGCTGTCTTGTAGAGTTAAGTATGCTAGACTCACAAATTTGAGTCAACTT[G/C]
ATAAAGACTACAGAGTCAAAAGTTTTGTGACATTTTTATGGTGCTTTATTTTTCCTTATTCATATCTTTTTCTTATCACAAGAATATTCAGTGGTATCAT

Reverse complement sequence

ATGATACCACTGAATATTCTTGTGATAAGAAAAAGATATGAATAAGGAAAAATAAAGCACCATAAAAATGTCACAAAACTTTTGACTCTGTAGTCTTTAT[C/G]
AAGTTGACTCAAATTTGTGAGTCTAGCATACTTAACTCTACAAGACAGCAAACTTCAATGGAAAGTGAGGAAAATCTGTGAGCTCTGCTTTTTCTTCTGT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	24.40%	18.90%	0.15%	56.54%	NA
All Indica	2759	9.00%	25.20%	0.22%	65.60%	NA
All Japonica	1512	58.50%	10.50%	0.00%	31.02%	NA
Aus	269	0.00%	1.50%	0.00%	98.51%	NA
Indica I	595	5.00%	18.20%	0.17%	76.64%	NA
Indica II	465	3.90%	9.00%	0.43%	86.67%	NA
Indica III	913	7.30%	39.50%	0.11%	53.01%	NA
Indica Intermediate	786	16.90%	23.40%	0.25%	59.41%	NA
Temperate Japonica	767	60.90%	17.20%	0.00%	21.90%	NA
Tropical Japonica	504	65.50%	3.00%	0.00%	31.55%	NA
Japonica Intermediate	241	36.10%	5.00%	0.00%	58.92%	NA
VI/Aromatic	96	3.10%	14.60%	0.00%	82.29%	NA
Intermediate	90	20.00%	24.40%	1.11%	54.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1105283911	G -> DEL	N	N	silent_mutation	Average:11.207; most accessible tissue: Callus, score: 67.012	N	N	N	N
vg1105283911	G -> C	LOC_Os11g09864.1	3_prime_UTR_variant ; 1322.0bp to feature; MODIFIER	silent_mutation	Average:11.207; most accessible tissue: Callus, score: 67.012	N	N	N	N
vg1105283911	G -> C	LOC_Os11g09860.1	upstream_gene_variant ; 2978.0bp to feature; MODIFIER	silent_mutation	Average:11.207; most accessible tissue: Callus, score: 67.012	N	N	N	N
vg1105283911	G -> C	LOC_Os11g09850.1	downstream_gene_variant ; 3934.0bp to feature; MODIFIER	silent_mutation	Average:11.207; most accessible tissue: Callus, score: 67.012	N	N	N	N
vg1105283911	G -> C	LOC_Os11g09870.1	downstream_gene_variant ; 982.0bp to feature; MODIFIER	silent_mutation	Average:11.207; most accessible tissue: Callus, score: 67.012	N	N	N	N
vg1105283911	G -> C	LOC_Os11g09850.2	downstream_gene_variant ; 3945.0bp to feature; MODIFIER	silent_mutation	Average:11.207; most accessible tissue: Callus, score: 67.012	N	N	N	N
vg1105283911	G -> C	LOC_Os11g09864.2	intron_variant ; MODIFIER	silent_mutation	Average:11.207; most accessible tissue: Callus, score: 67.012	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1105283911	NA	7.72E-06	Awn_length	Ind_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1105283911	NA	4.77E-12	mr1097_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105283911	NA	8.61E-07	mr1153_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105283911	5.38E-06	5.38E-06	mr1153_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105283911	NA	2.02E-06	mr1262_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105283911	5.27E-06	5.27E-06	mr1262_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105283911	NA	9.61E-08	mr1302_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105283911	NA	8.85E-06	mr1351_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105283911	NA	7.22E-06	mr1366_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105283911	7.27E-06	1.16E-06	mr1381_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105283911	4.78E-06	4.76E-06	mr1523_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105283911	NA	8.20E-07	mr1574_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105283911	NA	9.23E-06	mr1594_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105283911	NA	1.19E-09	mr1646_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105283911	NA	9.19E-06	mr1646_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105283911	NA	1.76E-06	mr1662_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105283911	NA	1.75E-06	mr1677_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105283911	NA	4.94E-10	mr1681_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105283911	NA	1.19E-06	mr1723_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105283911	NA	2.42E-08	mr1909_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105283911	2.85E-06	NA	mr1912_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251