\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1105281315:

Variant ID: vg1105281315 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 5281315
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.03, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:


CTTTTTGCCATTTTGGATCTAAACACTAGTAGCAAAACTTGACAATTTGGCATTTGGCATTTGCTAGTCCATAGTAGCAAATTGTGCCAAAAAGTGTTTT[G/A]
GGACCACTCCCTCTCTCTTTCTCTCTCTCACTTTAGTGCTAGAATGACAAAAGTTTAGGATGCATCTAAACACCTACTAGTACTTTTGCAATACCAAAAT

Reverse complement sequence

ATTTTGGTATTGCAAAAGTACTAGTAGGTGTTTAGATGCATCCTAAACTTTTGTCATTCTAGCACTAAAGTGAGAGAGAGAAAGAGAGAGGGAGTGGTCC[C/T]
AAAACACTTTTTGGCACAATTTGCTACTATGGACTAGCAAATGCCAAATGCCAAATTGTCAAGTTTTGCTACTAGTGTTTAGATCCAAAATGGCAAAAAG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 24.40% 4.00% 0.11% 71.56% NA
All Indica  2759 8.90% 1.00% 0.14% 89.96% NA
All Japonica  1512 58.50% 9.30% 0.00% 32.28% NA
Aus  269 0.00% 0.00% 0.00% 100.00% NA
Indica I  595 4.40% 2.20% 0.00% 93.45% NA
Indica II  465 4.10% 0.40% 0.00% 95.48% NA
Indica III  913 7.30% 0.00% 0.22% 92.44% NA
Indica Intermediate  786 17.00% 1.50% 0.25% 81.17% NA
Temperate Japonica  767 60.60% 17.20% 0.00% 22.16% NA
Tropical Japonica  504 65.70% 0.40% 0.00% 33.93% NA
Japonica Intermediate  241 36.50% 2.50% 0.00% 61.00% NA
VI/Aromatic  96 3.10% 11.50% 0.00% 85.42% NA
Intermediate  90 21.10% 10.00% 1.11% 67.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1105281315 G -> A LOC_Os11g09860.1 upstream_gene_variant ; 382.0bp to feature; MODIFIER silent_mutation Average:12.399; most accessible tissue: Callus, score: 78.565 N N N N
vg1105281315 G -> A LOC_Os11g09864.1 upstream_gene_variant ; 743.0bp to feature; MODIFIER silent_mutation Average:12.399; most accessible tissue: Callus, score: 78.565 N N N N
vg1105281315 G -> A LOC_Os11g09864.2 upstream_gene_variant ; 743.0bp to feature; MODIFIER silent_mutation Average:12.399; most accessible tissue: Callus, score: 78.565 N N N N
vg1105281315 G -> A LOC_Os11g09850.1 downstream_gene_variant ; 1338.0bp to feature; MODIFIER silent_mutation Average:12.399; most accessible tissue: Callus, score: 78.565 N N N N
vg1105281315 G -> A LOC_Os11g09870.1 downstream_gene_variant ; 3578.0bp to feature; MODIFIER silent_mutation Average:12.399; most accessible tissue: Callus, score: 78.565 N N N N
vg1105281315 G -> A LOC_Os11g09850.2 downstream_gene_variant ; 1349.0bp to feature; MODIFIER silent_mutation Average:12.399; most accessible tissue: Callus, score: 78.565 N N N N
vg1105281315 G -> A LOC_Os11g09860-LOC_Os11g09864 intergenic_region ; MODIFIER silent_mutation Average:12.399; most accessible tissue: Callus, score: 78.565 N N N N
vg1105281315 G -> DEL N N silent_mutation Average:12.399; most accessible tissue: Callus, score: 78.565 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1105281315 NA 3.61E-06 mr1046_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105281315 NA 5.17E-06 mr1095_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105281315 NA 7.52E-13 mr1097_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105281315 NA 2.72E-07 mr1153_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105281315 9.51E-07 9.51E-07 mr1153_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105281315 NA 3.96E-06 mr1239_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105281315 NA 1.77E-06 mr1262_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105281315 1.22E-06 1.22E-06 mr1262_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105281315 NA 9.54E-07 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105281315 NA 9.55E-08 mr1302_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105281315 2.34E-06 2.95E-07 mr1381_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105281315 5.65E-06 5.62E-06 mr1523_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105281315 8.60E-06 8.60E-06 mr1537_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105281315 NA 7.49E-06 mr1574_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105281315 NA 7.23E-06 mr1594_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105281315 3.22E-06 NA mr1624_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105281315 NA 2.67E-07 mr1624_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105281315 NA 1.03E-09 mr1646_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105281315 NA 7.79E-06 mr1646_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105281315 NA 8.70E-06 mr1661_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105281315 NA 2.90E-08 mr1681_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105281315 NA 5.69E-06 mr1702_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105281315 NA 2.79E-08 mr1723_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105281315 NA 6.67E-06 mr1890_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105281315 NA 3.14E-08 mr1909_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105281315 NA 6.13E-06 mr1943_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105281315 NA 5.23E-06 mr1980_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251